TABLE 1.

Primers for constructing replacement fragments

GeneaDirectionSequence
xylA (A)bForwardttgctcttcgttatttgtcgaacagataatggt
Reversettgctcttccatgcaagcctattttgaccagctc
MutageniccatagaccgtcgccTAGtcgtaatcatattg
xylA (D1)cForward1ttgctcttcgttacgccattaatggcagaagttg
Reverse1CACCCGAGTTACGATCAAATAGAGACCTCGTGGACATCcggctaactgtgcagtccgt
Forward2ATTTGATCGTAACTCGGGTGCGTACGCTGCAGGTCGACattgaactccataatcaggt
Reverse2ttgctcttcgttacagctcgctctctttgtgga
xylA (D2)dForwardcatccatcacccgcggcattacctgattatggagttcaatCGGCTAACTG
ReversecgctaccgataaccgggccaacggactgcacagttagccgATTGAACTCC
crp (D)dForwardtctggctctggagaaagcttataacagaggataaccgcgcTCCCGTCGGA
ReverseaaaatggcgcgctaccaggtaacgcgccactccgacgggaGCGCGGTTAT
rpoS (D)dForwardccagcctcgcttgagactggcctttctgacagatgcttacAAGGTGGCTC
ReversettgaatgttccgtcaagggatcacgggtaggagccaccttGTAAGCATCT
rseB (D)dForwardtgcccgttttgccaggagacgacggtagcccactctttgaTACTGCGATT
ReverseaggtgccaggaattcaaactttaggaacgcaatcgcagtaTCAAAGAGTG
yeiE (D)dForwardacgaaatcgacacagcaccagcatgttcttgtacagcaacAGTCGCTTAC
ReversettatatatttataattaatctttataagtggtaagcgactGTTGCTGTAC
ygaA (D)dForwardgcgcaataaacctgcaggatttctatcaggccgggattatTAATGGGCAT
ReversetctgattgtttttactctataaataaaattatgcccattaATAATCCCGG
yohI (D)dForwardaaagagctaacacattgtcaaaaaacatcactatggttttATCATCACCC
ReverseaggcgctaacatagcgcctcatttttttgcgggtgatgatAAAACCATAG
metA (D)dForwardtgtctaaacgtataagcgtatgtagtgaggtaatcaggttTCTTCTGTGA
ReversetaaggtgctgaatcgcttaacgatcgactatcacagaagaAACCTGATTA
  • a Mutation designations shown in parentheses: A, amber; D, deletion.

  • b Capital letters in the mutagenic primer indicate the amber codon. SapI recognition sites are in boldface.

  • c Barcode sequences are capitalized and primer-binding sites are italicized capitals. SapI restriction sites are in boldface.

  • d For forward primers, the 10 bases adjacent to the start codon are in boldface and the 10 nucleotides flanking the stop are capitalized. For reverse primers, the reverse complement of the 10 bases immediately after the stop and preceding the start are indicated in boldface and capitals, respectively.