TABLE 1.

Primers for constructing replacement fragments

GeneaDirectionSequence
xylA (A)b Forward ttgctcttcgttatttgtcgaacagataatggt
Reverse ttgctcttccatgcaagcctattttgaccagctc
Mutagenic catagaccgtcgccTAGtcgtaatcatattg
xylA (D1)c Forward1 ttgctcttcgttacgccattaatggcagaagttg
Reverse1 CACCCGAGTTACGATCAAATAGAGACCTCGTGGACATCcggctaactgtgcagtccgt
Forward2 ATTTGATCGTAACTCGGGTGCGTACGCTGCAGGTCGACattgaactccataatcaggt
Reverse2 ttgctcttcgttacagctcgctctctttgtgga
xylA (D2)d Forward catccatcacccgcggcattacctgattatggagttcaatCGGCTAACTG
Reverse cgctaccgataaccgggccaacggactgcacagttagccgATTGAACTCC
crp (D)d Forward tctggctctggagaaagcttataacagaggataaccgcgcTCCCGTCGGA
Reverse aaaatggcgcgctaccaggtaacgcgccactccgacgggaGCGCGGTTAT
rpoS (D)d Forward ccagcctcgcttgagactggcctttctgacagatgcttacAAGGTGGCTC
Reverse ttgaatgttccgtcaagggatcacgggtaggagccaccttGTAAGCATCT
rseB (D)d Forward tgcccgttttgccaggagacgacggtagcccactctttgaTACTGCGATT
Reverse aggtgccaggaattcaaactttaggaacgcaatcgcagtaTCAAAGAGTG
yeiE (D)d Forward acgaaatcgacacagcaccagcatgttcttgtacagcaacAGTCGCTTAC
Reverse ttatatatttataattaatctttataagtggtaagcgactGTTGCTGTAC
ygaA (D)d Forward gcgcaataaacctgcaggatttctatcaggccgggattatTAATGGGCAT
Reverse tctgattgtttttactctataaataaaattatgcccattaATAATCCCGG
yohI (D)d Forward aaagagctaacacattgtcaaaaaacatcactatggttttATCATCACCC
Reverse aggcgctaacatagcgcctcatttttttgcgggtgatgatAAAACCATAG
metA (D)d Forward tgtctaaacgtataagcgtatgtagtgaggtaatcaggttTCTTCTGTGA
Reverse taaggtgctgaatcgcttaacgatcgactatcacagaagaAACCTGATTA
  • a Mutation designations shown in parentheses: A, amber; D, deletion.

  • b Capital letters in the mutagenic primer indicate the amber codon. SapI recognition sites are in boldface.

  • c Barcode sequences are capitalized and primer-binding sites are italicized capitals. SapI restriction sites are in boldface.

  • d For forward primers, the 10 bases adjacent to the start codon are in boldface and the 10 nucleotides flanking the stop are capitalized. For reverse primers, the reverse complement of the 10 bases immediately after the stop and preceding the start are indicated in boldface and capitals, respectively.