TABLE 1.

PCR primers used in this study

PrimerSequence (5′-3′)
1mrAECCGGAATTCGATTGCAATTCAGTAAGGTGG (EcoRI site is underlined)
1mrABCGCGGATCCATGCTTTAGCTGTTGTTTCC (BamHI site is underlined)
MK1CAGTCAAAAGATCAGTCAGC
MK2TGCCGTAATACCCTTGCAGC
d1AAAAAGCCGGGTAGCTGCC
d2GATTTTCTCACGGGAATCTC
d3AACTCATAACATTCCCACCTTA
d4GCAATCAAAAATATGTGACTGG
d5CTTGATTCAATCAATCATCAATTGTCAAG
d3RTAAGGTGGGAATGTTATGAGTT
d4RCCAGTCACATATTTTTGATTGC
d5RCTTGACAATTGATGATTGAATCAAG
de11TTCTTGACAATTGATGATTGGCAATTCAGTAAGGTGGGAA
de12TTCCCACCTTACTGAATTGCCAATCATCAATTGTCAAGAA
PyxaG1GGTGAGGAAAAAAGGGTAGC
PyxaG2CTCCGGAGCAAATAAGGCAT
NlmrA1ACGGGGCTGAACCAGATTAT
NlmrA2CAGGAATGCAGCTGGAGATA
NlmrB1GTATTCGGATTCAGCAACGC
NlmrB2ATCATCAAGCAGGTGTGCAG
NyxaG1TAGATGAAGCAAAGCCTGCA
NyxaG2AAAGCGCAAAGCCTGAGGCT
NyxaH1TGCGGCAGCAAAATCACGGT
NyxaH2CAATAGGCTGCCACGACAGA