TABLE 2.

Oligonucleotide primers used in this study

Target gene(s)PrimersPrimers sequence (5′-3′)
rsbU, rsbV, rsbW, sigBSESigForTCACCAGTTCAAGGGTCTGA
SESigRevTCTTTGGAGCTTCGTCTGTG
icaR, icaADBCICAR1CTCGAATTTGTTACATACTAG
ICAC1CCATAGCTTGAATAAGGGAC
icaR, ica operon promoterPV1TTTGAAATCTCGAATTTGTTACAT
PV2CAATGATCGATTAAAGGGTTTTTC
rsbUVForGGAAGTAAGGAGGCGCATTT
rsbUVRevGCGCCAGCTCTTGAAAATAC
rsbU, rsbVrsbUForGGAAGTAAGGAGGCGCATTT
rsbU2CGACTTCTGGTAACACATCGAG
rsbU4AAAATTTGGCATGGATGCTT
rsbU5CGTCCAATTCTCCACCAACT
asp23SEasp23ForCATGAAAGGTGGCTTCACAG
SEasp23RevCATTACGTCGTCAACTTGCAT
csb9SEcsb9ForATTCGATGCGAGTGGAGATT
SEcsb9RevCGTGGAATTGATCCTGCTTT
rsbVSErsbVForTTGGTGGAGAATTGGACGTA
SErsbVRevCCTATCCGCTCTGAAACACC
RNAIIISERNAIIIForTGAAGTTATGATGGCAGCAGAT
SERNAIIIRevGTTGGGATGGCTCAACAACT
SEsarAForTCAGCTTTGAAGAATTTGCAG
SEsarARevTCTTTCATCGTGTTCATTACGTTT
sarASEsarA1TCCCTTCAAAACCAAACGAA
SEsarA2AATTCAGGACATGCACCACA
SEsarA3AAAAGATGGGTTTTAAGATTTATGGA
SEsarA4CTGTCAGCATAAGTGACCATAGC
icaAKCA1AACAAGTTGAAGGCATCTCC
KCA2GATGCTTGTTTGATTCCCT
icaRKCR1GGTAAAGTCCGTCAATGGAA
KCR2CGCAATAACCTTATTTTCCG
gyrBGYR1TTATGGTGCTGGACAGATACA
GYR2CACCGTGAAGACCGCCAGATA