TABLE 2.

Primers used in this study

PrimerSequence
Degenerate primers
    N terminal5′ GCNCCNACNCARGGNGAYGGNACN 3′
    C terminal5′ NARRTARTTNARNGTRAARTTNGC 3′
Adapter sequence5′ GATCCTAATACCACTCACATAGGGCGGCCGCCCGGGC 3′, 3′ GATTATGGTGAGTGTATCCCGCCGGCGGGCCCG 5′
WP15′ GATCCTAATACCACTCACATAGGGCGGCCGCCCGGGC 3′
Biotinylated primer (BP1)5′ GTGTTCAGGTTTTGATTCACCACCATC 3′
IP25′ GTTCTTGATTGAACAGGCTGC 3′
Primers for amplifying 537-bp fragment
    Forward primer5′ GGATCCATGAAACTTAACACAATTGGC 3′
    Reverse primer5′ AAGCTTAAGGTAGTTGAGAGTGAAGTTG 3′
Primers for point mutations
    Val32Ala (forward)5′ CTCAAGGTGACGGCGCAGCAAAATTCACCGGTTCTATTATTAATG 3′
    Phe34Ala (forward)5′ GGTGACGGCGCAGTTAAAGCAACCGGTTCTATTATTAATGC 3′
    Ile38Ala (forward)5′ GCAGTTAAATTCACCGGTTCTGCAATTAATGCAGCCTGTTCAATC 3′
    Triple mutation (forward)5′ CTCAAGGTGACGGCGCGCAAAGCAACCGGTTCGCAATTAATGCAGCCTGTTCAAT
        (Val-Phe-Ile→Ala-Ala-Ala)    CAAG 3′