TABLE 2.

Primers used for PCR and sequencinga

PrimerNucleotide sequence (5′-3′)Position (bp)/gene/accession no./reference
VS174CATCTAGAGGAAGCAGTAGACGAAATCG19931-19950/L0097/AF125520
VS175CATCTAGAGGTCTTCTTCCGGTTTGTTC24224-24205/L0105/AF125520
VS177ATCCCGGGTGAGGCATAACCTGATTCGTG22700-22720/region between stx2 and L0105/AE125520
VS178ATCCCGGGTTCATATACAGGTGTTCCTTTTGG21466-21443/region between argO and stx2/AE125520
VS244ACGTCTAGATGAGCAAGATGCTGAATCACTG2688-2667/Z0443/AE005214
VS245CGAGTCGACCATTCACCACCCTGAATTGAC1174-1194/lacI-Z0442 intergenic region AE005214
VS246CGAGTCGACAGAGATTACAAAGTTGAATCGTCAG6257-6231/lacA/AE005213
VS247ACGTCTAGAACTGTTACAGATGATCCCACTGC4685-4706/cynS/AE005213
VS256CAGTCTAGACAGGTAAGGTTTATCTG15241-15221/escD/AE071034
VS257CAGGTCGACTATATACCTTTGATAATTTTC13742-13765/sepL-espA intergenic/region AE071034
VS264CAGGTCGACGCAACATCCGTTGTTAATGTTGAG13726-13704espA/AE071034
VS265CAGTCTAGATCCCGGCAGAACGAATACCGTTC12256-12278/espD/AE071034
VS266CAGGTCGACAATTTCACACAGGATACAGCTATG11304-11287lacZ/AE005213
VS268CAAATTGCCACTCACCATTCAG11100-11121/lacZ/AE005213
VS269TTGAATTATGGCCCACACCAG8451-8431/lacZ/AE005213
VS270TGTATTGTAACAGTGGCCCGAAG7854-7876/lacY/AE005213
VS275CCGGTTATTTACCAAGGGATATTGC13159-13183/espA/AE071034
VS276AAATGGCGCCTCTTTACTTGACTG14266-14242/sepL/AE071034
VS280CAGGTCGACCCTGATAAGCGAAGCGTATCAGGC6191-6214/cynX-lacA intergenic region/AE005213
VS303CATCTAGAGATTCCGTTCTCCGTTATGC3045-3026/acrB/AE005213/AE005225
VS304CAGTCGACTCGGACATACTTCTACCCATG1630-1650/ybaJ-hha intergenic region/AE005225
VS305CAGTCGACACTACTGAACAACATAAAGGTG1771-1792/ybaJ/AE005225
VS306CAGTCGACTCGCTTTCGGAGCTATAACCG1409-1388/ylaD-hha intergenic region/AE005225
VS307CATCTAGAGCTGGCAGGAGATAAGGAGGT1-20/downstream of ylaC/AE005225
VS308ACGGATCCATGGTATTAATATGCAGGATC1769-1746/hha/AE005225
VS309CAGGATCCCCGGTTATAGCTCCGAAAG1389-1409/hha/AE005225
VS317ACGTCGACCCGGTTATAGCTCCGAAAG1389-1409/hha/AE005225
VS318ACGAATTCAATGTCCGAAAAACCTTTAACG1637-1619/hha/AE005225
VS319CCGTTGAAGTGAAAGACGGTC1453-1474/gapA/AE005401
VS320AACCACTTTCTTCGCACCAGC1638-1618/gapA/AE005401
VS323TGTGGATGCCAAAATTGCTG13493-13474/espA/AE071034
VS324CGCCTTCACTGTTTGCAGATC13322-13342/espA/AE071034
VS327CATCTAGAACAGGCTCTAAAACGGTTAAC41697-41677/LEE/AE071034
VS328CAGTCGACGCTTTAATATTTTAAGCTATTAGCG40200-40222/LEE/AE071034
VS330CATCTAGACTTATCCTCTGGTATGATATCTTC38596-38619/LEE/AE071034
VS331CAGGATCCATGCGGAGATTATTTATTATG40199-40173/lerORF/AE071034
VS332CAGTCGACATGTTAAATATTTTTCAGCGG39806-39827/lerORF/AE071034
VS339AAAGACATGATATCGGCACAGC2018-1918/ybaJ/AE005225
VS340TGAGCATATTGCGACCTTCG1882-1864/ybaJ/AE005225
VS341CGGAATTCGTCCAGATGACA8153-8168/hilApromoter/AE008831.1/14
VS342TGGGGTGTAAATGCTGCTT8627-8609/hilApromoter/AE008831.1/14
VS353GCTTAACCACCTCATCCTTCG13639-13659/espApromoter/AE071034
VS354GACTGGTTGCTGGAGAGAGTCC13982-13963/espApromoter/AE071034
VS355GAATGTATGGACTTGTTGTATGTG40139-40162/lerpromoter/AE071034
VS356TTTGTTTATGCAATGAGATCTATC40526-40505/lerpromoter/AE071034
VS376AGTCCATCATCAGGCACATTAG39985-40006/lerORF/AE071034
VS371CAGGATCCATGAAGAAGATGTTTATGGCGG22433-22454/stx2B/AF125520
VS372CAGTCGACTCAGTCATTATTAAACTGCACTTCAG22702-22676/stx2B/AF125520
VS377CATACAACAAGTCCCATACATTC40160-41139lerORF/AE071034
VS398GAGTCGACCATGAAATAATTAAATGATAACG30809-39787/LEE/AE071034
VS415GGAGTCGACGAATAAAAACCAAGCTGAACC40534-40554/LEE/AE071034
VS426GCAGTTCCTTTGCTTCATTG39642-39662/LEE/AE071034
VS427GCCTTCCTGTAACTCGAATTAAG40593-40571/LEE/AE071034
  • a The position of the primer sequence represents the location in the published sequence deposited under the indicated accession number at NCBI. Underlined sequences GGATCC, GAATTC, GTCGAC, CCCGGG, and TCTAGA represent restriction sites for BamHI, EcoRI, SalI, SmaI, and XbaI, respectively.