TABLE 1.

Primers

NameSequenceLength (bp)
NACTTTATTGTCATAGTTTAGATCTATTTTG30
N2TCAGTTTAAGACTTTATTGTC21
SATAATCCTTAAAAACTCCATTTCCACCCCT30
S2CAGTTCCCAACTATTTTGTCC21
CEKG2AGGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG34
CEKG2BGGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC35
CEKG2CGGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT35
CEKG4GGCCACGCGTCGACTAGTAC20
fic1ATGCATTTAGACAGGCAGAGT21
fic2ACTGCGTGATGCCTTTAATGA21
oorD1ATGGCTAAAATGAGCGCTCCA21
oorD2TCTCCCTTCTAAAATAGTCTC21
porA1ATGGCAAAAAGTATTGAATTG21
porA2AAAAAAGCTCATTTTAGGGCC21
0190-1GCTCAGACTTTTTAGTGGGTCGTTTTTG28
0190-2NACGCGTCGACTTAAAGCTCTCTTTCAGGAAG31
0190-3NATCCACTTTTCAATCTATATCTTTTACCCCACGATTGGCCGC42
0190-4NCCCAGTTTGTCGCACTGATAACCTTACCAATTCCCTTTCATC42
0226-1GCTCTAGAATGGAAGAATCAACAGCGTTT29
0226-2ACGCGTCGACTTACCCCATAATGAGCTTGTG31
0226-3ATCCACTTTTCAATCTATATCGGTGTAGCACACCACCACCAC42
0226-4CCCAGTTTGTCGCACTGATAAGCTCGCCGGTTTTGTTACCGG42
0707-1GCTCTAGAGGGGATTGTTTGCAAGAAATA29
0707-2ACGCGTCGACCTCATATAACTTACTCATGGC31
0707-3ATCCACTTTTCAATCTATATCTTGAGCGTTCAATTCGCTTTC42
0707-4CCCAGTTTGTCGCACTGATAAACGCTAAGGATTTGAGCGAGT42
1019-1GCTCTAGATTTAAGGAAGTAACCATGATG29
1019-2ACGCGTCGACCCACCCCTATCATTTCACCAA31
1019-3ATCCACTTTTCAATCTATATCGAATCATGCCACCCAAATCCC42
1019-4CCCAGTTTGTCGCACTGATAAAAACCCTAACAAAAAAGAAAC42
1505-1GCTCTAGACATGAGACTTTATGAGAGTTT29
1505-2ACGCGTCGACAATCTTAAGAGTTTTCTATCC31
1505-3ATCCACTTTTCAATCTATATCTTGAACAAATTAAAACGCCCC42
1505-4CCCAGTTTGTCGCACTGATAAACCATAAGAACGGACAACCCC42
C1GATATAGATTGAAAAGTGGAT21
C2TTATCAGTGCGACAAACTGGG21
Rdx1CTATCCGGAGTCTTATAA18
Rdx2TGAATCTCACGCCAAGCA18
CAT5BamGAGGGTTTCGGGATCCGATAGATTTATGATATAGTGG37
CAT3BamATTTGGGCGGGGATCCCGCACTACTCTCGACAGAGAG37