TABLE 1.

Primers used in this studya

No.Primer setSequence (5′→3′) (Restriction enzyme sites)Targeted region
1ahrpY-D1TGATGGCCAGCATTTCGGC2.8-kb hrpY-hrpL
1bhrpL-f1AAGGATCCGATGGAGAGTTAATGAAATG (BamHI)
2ahrcJ-D1ACCAGGGCTTGCCGAAACGC3.4-kb hrcJ-hrpY
2bhrpY-C1GGAAGCTTCGCAGAGTACGCTGATGATCGCTGACGATC (HindIII)
3ahrpY-D1TGATGGCCAGCATTTCGGC3.8-kb hrpY-hrpJ
3bhrpJ-A1TCGTTGCAGCGTACGCAGCC
4ahrpL-B2GCGTACTCTGCGAAGCTTCCTCCACGGTATTGGCAGGGGT (HindIII)2.0-kb hrpL-hrcV
4bhrcV1CCGAACGCCTCCACCACGTG
5ahrcJ-D1ACCAGGGCTTGCCGAAACGC3-kb hrcJ-hrpS
5bhrpS-f1 GAGCTCGGATCCAGCGTTTAATCGCCTGA (SacI, BamHI)
6ahrpY-C1GGAAGCTTCGCAGAGTACGCTGATGATCGCTGACGATC(HindIII)3-kb hrpY-hrpA
6bhrpA-r1GTCGACTACCTAGAATTCATCAG (EcoRI)
7ahrpXY-f1 GAGCTCGGATCCGCCAGGCTGTTGATGC (SacI, BamHI)2.5-kb hrpX-hrpY
7bhrpXY-r1ACGAAGGGAGGACTCTAGAC (XbaI)
8ahrpY-FBamHITCTGGAGGAGGATCCGCGAATG (BamHI)0.7-kb hrpY
8bhrpY-RHindIIITACAAGCTTTCATCAGGCGA (HindIII)
9ahrpS-f1 GAGCTCGGATCCAGCGTTTAATCGCCTGA (SacI, BamHI)1.45-kb hrpS
9bhrpS-r1ACAGCCCGATAAATCTAGAGCC (XbaI)
10ahrpL-f1AAGGATCCGATGGAGAGTTAATGAAATG (BamHI)0.55-kb hrpL
10bhrpL-r1TTGAATTCTTATGCATCAACGGCCTGGC (EcoRI)
11ahrcJ-f1TGCACTAGTCAGGATCAAACCC (SpeI)0.97-kb hrcJ
11bhrcJ-r1CATCGGCTACACGTAGAATTCTCA (EcoRI)
12ahrpA-f1ATCGGGCTGTATACTAGTATCACC (SpeI)0.3-kb hrpA
12bhrpA-r1GTCGACTACCTAGAATTCATCAG (EcoRI)
13abcsA-f1ACCCGAATTCCTATATTCGCCGTCACC (EcoRI)3-kb bcsA
13bbcsA-r12CCCACGCACAGGGACAACA
14aRT-hrpLf1GGGTATTTGGACTTGCCCTGAATC223-bp hrpL
14bRT-hrpLr2GCATCCAGCAGCATCATCAACATC
15ahrpN1GCGGCATGGCGAAAGAGAT226-bp hrpN
15bhrpN2GTGTTGCCGGTATCACCC
16aRT-rplUf1GTTTGACCAGGTTCTGATGGTTGC162-bp rplU
16bRT-rplUr1CCAGCCTGCTTACGGTAGTGTTTA
  • a Primer sets 1 through 13 were used to amplify hrp and hrc genes for construction of plasmids used for allelic exchange mutagenesis and complementation experiments. Primer sets 14 through 16 were used for RT-PCR. Restriction sites in primers are in boldface type.