TABLE 1.

Strains and oligonucleotides used in this study

Strain or primerGenotype or sequenceReference or source
Strains
    S. coelicolor
        M600SCP1 SCP228
        M145SCP1 SCP228
        J660bldC18 mthB2 cysD18 agaA7 SCP1NF SCP2*34
        J2161ΔbldC::apr derivative of M600This work
        J2162ΔbldC::apr derivative of J660This work
        J2166ΔbldC derivative of M600This work
        J2167ΔbldC::apr derivative of M145This work
        J2168ΔbldC derivative of M145This work
        J2169bldC+ derivative of J660This work
        J3210bldC18 derivative of M600This work
        J3211bldC18 derivative of M145This work
        J1700bldA39 hisA1 uraA1 strA1 SCP1 SCP230
        J669bldB43 mthB2 cysD18 agaA7 SCP1NF SCP2*34
        J774bldD53 cysA15 pheA1 mthB2 strA1 SCP1NF SCP2*34
        166bldF hisD3 pheA1 strA1 SCP1+ SCP2+43
        WC103bldG103 hisA1 uraA1 strA1 PglSCP1 SCP27
        WC109bldH109 hisA1 uraA1 strA1 PglSCP1 SCP27
        HU261bldJ261 hisA1 uraA1 strA1 Pgl SCP1NF SCP2*50
        NS17bldK::aadA derivative of M14539
        J2151ΔglkA119 bldM::hyg SCP1 SCP235
        J2177ΔglkA119 bldN::hyg SCP1 SCP22
Primers
    Cloning and mutagenesis primers
        BLDC1CGTCGCTTGGAGCTGTGGTTCC
        BLDC2TGCCGACAAGGGACGTAGGTCC
        BLDC5CCGCATATGACCGCTCGTACCCCGGACGCTGAGCCGCTGCTGACC
        BLDC6CCCGGTTATTCAGTTGTTCAGG
        Y49F FORTTCCGCGAAGCCGAGGTCCG
        Y49F REVGCGGCGATGCCCGCCGAGCG
    Gene disruption primers
        BLDC K-OUT FORATGAACCGAGAAGGTTCGGTTCTCCCGAGGAGGCCGCTCATTCCGGGGATCGTCGACC
        BLDC-K-OUT REVGGTTGGGGGACCCGCCGTTCTGCCCGGTTATTCAGTTGTTGTAGGCTGGAGCTGCTTC
    S1 nuclease mapping and runoff primers
        BLDC2See cloning and mutagenesis primers
        BLDC3aGAACATGGTGGCGACCTCAGCC
        BLDC4TATATACTGTGACTGATCGTCACAGAGG
        BLDC17GAGCGGCCTCCTCGGGAG
        BLDC25aGCACCTTGACCCGCGTTGCC
        ACTIIORF4.1aGTACGTCTGCAGCGTCGTCATGGCGCT
        ACTIIORF4.2ATCGGAGATCGCTTGTGACGGCA
        HRDB FORCGCAAGGTACGAGTTGATGACC
        HRDB REVaCCATGACAGAGACGGACTCGG
        REDD.1aGATCGATACGGGTCCCAATA
        REDD.JW2CATGGATCCTGCTTCGTTTGCGTCGTTCAGTTC
        REDZ.1aCTCCAGCAATGCGCGAAT
        REDZ.2CGTGCACGTGTCCTTCTG
  • a Labeled primers.