TABLE 1.

Strains and oligonucleotides used in this study

Strain or primerGenotype or sequenceReference or source
Strains
    S. coelicolor
        M600SCP1 SCP2 28
        M145SCP1 SCP2 28
        J660 bldC18 mthB2 cysD18 agaA7 SCP1NF SCP2* 34
        J2161ΔbldC::apr derivative of M600This work
        J2162ΔbldC::apr derivative of J660This work
        J2166ΔbldC derivative of M600This work
        J2167ΔbldC::apr derivative of M145This work
        J2168ΔbldC derivative of M145This work
        J2169 bldC + derivative of J660This work
        J3210 bldC18 derivative of M600This work
        J3211 bldC18 derivative of M145This work
        J1700 bldA39 hisA1 uraA1 strA1 SCP1 SCP2 30
        J669 bldB43 mthB2 cysD18 agaA7 SCP1NF SCP2* 34
        J774 bldD53 cysA15 pheA1 mthB2 strA1 SCP1NF SCP2* 34
        166 bldF hisD3 pheA1 strA1 SCP1+ SCP2+ 43
        WC103 bldG103 hisA1 uraA1 strA1 PglSCP1 SCP2 7
        WC109 bldH109 hisA1 uraA1 strA1 PglSCP1 SCP2 7
        HU261 bldJ261 hisA1 uraA1 strA1 Pgl SCP1NF SCP2* 50
        NS17 bldK::aadA derivative of M145 39
        J2151ΔglkA119 bldM::hyg SCP1 SCP2 35
        J2177ΔglkA119 bldN::hyg SCP1 SCP2 2
Primers
    Cloning and mutagenesis primers
        BLDC1CGTCGCTTGGAGCTGTGGTTCC
        BLDC2TGCCGACAAGGGACGTAGGTCC
        BLDC5CCGCATATGACCGCTCGTACCCCGGACGCTGAGCCGCTGCTGACC
        BLDC6CCCGGTTATTCAGTTGTTCAGG
        Y49F FORTTCCGCGAAGCCGAGGTCCG
        Y49F REVGCGGCGATGCCCGCCGAGCG
    Gene disruption primers
        BLDC K-OUT FORATGAACCGAGAAGGTTCGGTTCTCCCGAGGAGGCCGCTCATTCCGGGGATCGTCGACC
        BLDC-K-OUT REVGGTTGGGGGACCCGCCGTTCTGCCCGGTTATTCAGTTGTTGTAGGCTGGAGCTGCTTC
    S1 nuclease mapping and runoff primers
        BLDC2See cloning and mutagenesis primers
        BLDC3aGAACATGGTGGCGACCTCAGCC
        BLDC4TATATACTGTGACTGATCGTCACAGAGG
        BLDC17GAGCGGCCTCCTCGGGAG
        BLDC25aGCACCTTGACCCGCGTTGCC
        ACTIIORF4.1aGTACGTCTGCAGCGTCGTCATGGCGCT
        ACTIIORF4.2ATCGGAGATCGCTTGTGACGGCA
        HRDB FORCGCAAGGTACGAGTTGATGACC
        HRDB REVaCCATGACAGAGACGGACTCGG
        REDD.1aGATCGATACGGGTCCCAATA
        REDD.JW2CATGGATCCTGCTTCGTTTGCGTCGTTCAGTTC
        REDZ.1aCTCCAGCAATGCGCGAAT
        REDZ.2CGTGCACGTGTCCTTCTG
  • a Labeled primers.