TABLE 1.

Primers employed in this study

PrimerSequence (5′ to 3′)a
A68-25(+) GACGACGACAAGATATGCGCACCTTTTAGCAAATC
A68-49(+) GACGACGACAAGATGGAAAACACCCAAAATTTTG
A68-73(+) GACGACGACAAGATCGCTTCAGAGCTAAAAGC
A68-98(+) GACGACGACAAGATTGCTAAGGAAAAATTTGATTTC
A68-130(+) GACGACGACAAGATCTCATCTTTAGATTATAAAAAAG
A68-160(+) GACGACGACAAGATTGGAAGATTGATTTATCACAT
A68-227(−) GAGGAGAAGCCCGGTTTACTCATTATCTTGAGTATTTTG
A68-251(−) GAGGAGAAGCCCGGTCTATTAGTAAAAGGCAGGTTTT
A69-25(+) GACGACGACAAGATATGTGCACCTTTTAACAAAAT
A69-263(−) GAGGAGAAGCCCGGTTTAATAAAAGGCAGATTGTAAAGAATC
A68cc1m1FGAAAATATACAAAAAGCTAAAAGTGCTAAGG
A68cc1m1RCCTTAGCACTTTTAGCTTTTTGTATATTTTC
A68cc1m2FGAAAATATACAAGTAGCTAAAGTTGCTAAGG
A68cc1m2RCCTTAGCAACTTTAGCTACTTGTATATTTTC
A68cc2m1FATAGAAAAATCAAAAGAAATTCATGAAATAC
A68cc2m1RGTATTTCATGAATTTCTTTTGATTTTTCTAT
A68cc2m2FAAAAGAAATTCATGAAATACATAAAAAAAATTCCG
A68cc2m2RCGGAATTTTTTTTATGTATTTCATGAATTTCTTTT
A68cc2m3FATAGAAAAATTAGAAGAAACTCTTGAAATAC
A68cc2m3RGTATTTCAAGAGTTTCTTCTAATTTTTCTAT
A68cc2m4FAAAAGAAATTGTTGAAATAGTTAAAAAAAATTCCG
A68cc2m4RCGGAATTTTTTTTAACTATTTCAACAATTTCTTTT
A68cc2m5FAAAAGAAATTCTTAAAATACTTGAAAAAAATTCCG
A68cc2m5RCGGAATTTTTTTCAAGTATTTTAAGAATTTCTTTT
A68cc3am1FCTAAATCATTGCAAATGCAAAAAAAATCCAAC
A68cc3am1RGTTGGATTTTTTTTGCATTTGCAATGATTTAG
A68cc3am2FGCTAATGCAAAAAAAATCCAACTCAGAGATAAAAC
A68cc3am2RGTTTTATCTCTGAGTTGGATTTTTTTTGCATTAGC
A68cc3am3FCTAAATCATTGCTAAAGCAAATAGAATCCAAC
A68cc3am3RGTTGGATTCTATTTGCTTTAGCAATGATTTAG
A68cc3bm1FCTTAAAAAAACCTCAAACGAAACTCATAAAGTTTACAATC
A68cc3bm1RGATTGTAAACTTTATGAGTTTCGTTTGAGGTTTTTTTAAG
A68cc3bm2FCTTAAAAAAACCTTAGACGAAGCTCTTAAAGTTTACAATC
A68cc3bm2RGATTGTAAACTTTAAGAGCTTCGTCTAAGGTTTTTTTAAG
  • a Underlining indicates the tail sequences incorporated into each primer to allow for annealing with LIC vectors as described in the text.