TABLE 2.

Oligonucleotide primers used in this study

NameSequenceaRelevant description
luxSpFCCACTCGTGAGTGGCCAAUpstream primer for cloning luxS promoter
luxSpRGGTATGATCGACTGTGAAGCTATCTAADownstream primer for cloning luxS promoter
pfspFCCGGAATTCAAAATTTCTTTGGCGATGTAGCGUpstream primer for cloning pfs promoter
pfspRCGCGGATCCAGTTGGCCGGTATAGATTTCGCDownstream primer for cloning pfs promoter
lsrpFCCGGAATTCGCGACCTGTTCTTCTTCACACATTUpstream primer for cloning lsr operon promoter
lsrpRCTCGGATCCTCGATGCCTTTCAGGACATTGDownstream primer for cloning lsr operon promoter
lsrpMATAGCATAAATCGATCTCTATTCGTCGGAAATATGTGCAATGPrimer for making mutation of lsr operon promoter
crpHP1ACTCTCGAATGGTTCTTGTCTCATTGCCACATTCATAAGTGTAGGCTGGAGCTGCTTCPrimer for deletion of crp gene
crpHP2AAACGACGATGGTTTTACCGTGTGCGGAGATCAGGTTCTGCATATGAATATCCTCCTTAGPrimer for deletion of crp gene
luxSHP1ATGCCGTTGTTAGATAGCTTCACAGTCGATCATACCCGGAGTGTAGGCTGGAGCTGCTTCPrimer for deletion of luxS gene
luxSHP2CTAGATGTGCAGTTCCTGCAACTTCTCTTTCGGCAGTGCCCATATGAATATCCTCCTTAGPrimer for deletion of luxS gene
lsrRHP1ATGACAATCAACGATTCGGCAATTTCAGAACAGGGAATGTGTGTAGGCTGGAGCTGCTTCPrimer for deletion of lsrR gene
lsrRHP2TGATCGGTAACCAGTGCGTTGATATAACCGCCTTTCATTGCATATGAATATCCTCCTTAGPrimer for deletion of lsrR gene
lsrKHP1GCGTGAAGGCATTGTTTTATATAACAATGAAGGAACACCGTGTAGGCTGGAGCTGCTTCGPrimer for deletion of lsrK gene
lsrKHP2TCCGCCTGCAAAGACTAACGATGAAGGATGAATAGTCGAATTCCGGGGATCCGTCGACCPrimer for deletion of lsrK gene
lsrHP1CGCTCGGTTTATAAACAGTATTCAGGGGTCAATGTCCTGAGTGTAGGCTGGAGCTGCTTCPrimer for deletion of lsrACDBFG operon
lsrHP2AGATTCCAGTTTCGCGACACAGGTTTTGTAGTGGGGCGTGCATATGAATATCCTCCTTAGPrimer for deletion of lsrACDBFG operon
  • a The underlined sequences anneal to the template plasmid, while the remaining sequences correspond to the ends of the indicated genes.