TABLE 2.

Oligonucleotides used for PCR experiments

PrimerOligonucleotide sequence (5′ → 3′)PCR product size (bp)Use
yfgL1ATGATGCAGATGAAAATTAATAATTTGTCCATCTGA1,148ΔyfgL isogenic mutant construction
GAGGGACCCGAAAGCCACGTTGTGTCTCAA
yfgL2CGGCCCCTGTCCAGGAGCCGTTTTCAAAGTGAACG
ACAGAGACGAGCGCTGAGGTCTGCCTCGTG
A2GBL-3AAAGCCACGTTGTGTCTCAA957Kanamycin resistance cassette amplification
B2GBLnp5TTAGAAAAACTCATCGAGCA
yfgL3GTAGTGCATGGGAAGCAGGC1,378Isogenic mutant verification
yfgL4TAAATCATCAGACAACGCACGC
yfgL5CGTGGAGCACTTCCGTTGG941Isogenic mutant verification
yfgL6GCTGGGCAACGAAACGACC
yfgLXbaICCCGGGTCTAGATCCATCTGAGAGGGACCCGATGC1,263Cloning of yfgL
yfgLPstlCTGCAGCGGCCCCTGTCCAGGAGCCG