TABLE 1.

Bacterial strains, plasmids, and primers

Strain, plasmid or primerDescription or sequence (5′-3′)Source or reference
Strains
    E. coli S17-1thi pro hsdR recA with RP4-2[Tc::Mu, Km::Tn7]42
    E. coli HMS174Host for phaCAB16
    R. rubrum
    M. gryphiswaldense R3/S1Rifr, Smr spontaneous mutant39
    M. gryphiswaldense Da97Insertion mutant with truncated fragment I of mms16This work
    M. gryphiswaldense Da126Insertion mutant with truncated fragment II of mms16This work
    M. gryphiswaldense Da127Insertion mutant with truncated fragment III of mms16This work
    E. coli HMS174Host for phaCAB and/or phaP16
    E. coli HMS174(pCS11)Host for phaCAB and pCS11 (mms16-egfp)This work
Plasmids
    pK19mobsacBKmr, sacB modified from B. subtilis, lacZα35
    pBBR1MCS2Kmr, lacZα18
    pBBR1MCS5Gmr, lacZα18
    pGEM-T EasyAmpr, lacZα, PCR cloning vectorPromega
    pJM9238phaCAB16
    pSN2389apdA-ygfp fusion in pBBR1MCS211
    pCS11mms16-egfp fusion in pBBR1MCS211
    pDa97pK19mobsacB, containing 403-bp fragment I of mms16This work
    pDa126pK19mobsacB, containing 309-bp fragment II of mms16This work
    pDa127pK19mobsacB, containing 271-bp fragment III of mms16This work
    pDa168pBBR1MCS5 with apdA-ygfp fusionThis work
    pABC1mamC in pCR-TOPO 2.1 (Invitrogen)
    pABC2mamC-egfp fusion in pEGFP-N3 (Clontech)
    pABC3mamC-egfp fusion in pBBR1MCS2
Primers
    mmpF1GGCAGAGCAGCTTTTTGACTTTG
    mmpB1TTCGCGCATGTTGGACAAC
    mmpB2CGAACACGTCGCGCATTTC
    mmpF2TGGACGACCACAAGGTTCCC
    mms16fo6CATTGCGATGATGGCTGTGC
    mms16rw6TGCGGAACAAGGTGGATTTG
    M13fwGTAAAACGACGGCCAGT
    M13rwCAGGAAACAGCTATGAC
    MamCSallrevGTCGACGGCCAATTCCCTCA
    MamCforTAAGCCTGACCCTTGAAT