TABLE 1.

Genomic islands in six sequenced staphylococcal genomes

InlandGenes found on islandbType, location of island (predicted integration sequencea) for:Allele family member(s)
S. aureusS. epidermidis
COLMu50N315MW2RP62AATCC 12228
vSa1Enterotoxin genes (seb, tsst, ear)903332-919283 (A)NPNPNPNPNPSaPI1, SaPI3
vSa2sec, tsstNPNPNPNPNPNPSaPIbov
vSa3Type I, fhuD; type II, sel2, sec4, earNPI, 868373-882872 (B)NPII, 839358-853808 (B)NPNPSaPI3
vSa4Type I, sel, sec3, tsst; type II, four unknown ORFsII, 2072899-2076041 (C)I, 2148912-2133235 (D)I, 2056679-2072358 (D)II, 2097809-2100950 (C)NPNPSaPI2
vSaαType I, set6-15, lpl1-9; type II, set16-26, lpl10-14, type III, set1-5, lpl2,7,8,11,13III, 465424-489723I, 461919-491326I, 436162-466813II, 416307-452099NPNP
vSaβType I, splA-F, lukDE, ear, epidermin gene cluster; type II, splA-F, lukDE, ear, seg, sen, sei, sem, seo, epidermin gene clusterI, 1902466-1938731II, 1932523-1961464I, 1854608-1881615I, 1890800-1922552NPNP
vSaγset, eta, psmβ1173206-11933581208629-12302191132235-11537751133469-1153549NPNP
vSeγpsmβ734975-737635840908-843572
SCCmecmecA, ermA, bleO, addDI, 68085-34173 (E)II, 87085-34158 (E)II, 87119-34153 (E)IV, 58278-34150 (E)II, 2536574-2584194 (F)NPTypes I, II, III, IVa, IVb
SSCpbp4pbp4, merT, merB, merA, tagFNPNPNPNPNP32031-99960 (G)
φSa172 ORFsNP917453-962005 (H)NPNPNPNPφ11, φETA
φSa2lukS-PV, lukF-PVNPNPNP1575042-1529123 (I)NPNPφSLT
φSa3sak, sea, sep, seg2, sek2NP2126304-2083238 (J)2049591-2005321 (J)2088820-2046205 (J)NPNPφ42
φCOLIntegrated in geh354674-398267 (K)NPNPNPNPNPφL-54
φSPβIntegrated in yeeE, LPXTG surface protein geneNPNPNPNP1567637-1694334 (L)NP
Tn5801tetM, two unknown ORFsNPI, 436002-461791 (M)NPII, 415784-417798 (M)NPNP
vSe1Type I, cadCD; type II, one unknown ORFNPNPNPNPI, 2250348-2267496 (N)II, 2255537-2259992 (N)
vSe2srtA, two LPXTG surface protein genesNPNPNPNPNP1558081-1519667 (O)
  • a A, TTATTCCTGCTAAATAA; B, TCCCGCCGTCTCCAT; C, GTTTTACATCATTCC[CT]GGCAT; D, GTTTTACATCATTCCCGGCAT; E, TTATGATA[CA]GC[CT]TCT; F, TTATGATA[TA]GCTTCT; G, TCATTTATGATATGCTTCT; H, TCGAAATGGAAGGTAGTATTGGATAGCTTTAAAC[CA][CG]CGTTGTTAAGCCATTCTTGACTTCCGGAAATGG[CG]TAT; I, AAATAAACATATC[GA]TCATAATGTGATGGT; J, TGTATCCAAACTGG; K, ATCATACAAGGATGGGAT; L, CAATGCATAAAA; M, GAGTGGGAATA; N, CTAAATATTTTC; O, CGGAGAGTGAGGGAT. NP, not present.

  • b Gene symbols: sortase, srtA; cadmium efflux, cadCD; lipase, geh; staphylococcal kinase, sak; β-lactamase, ear; ferric hydroxamate uptake, fhuD; leukotoxin, lukDE; tandem lipoprotein, lpl; PSM beta subunit, psm β; staphylococcal entertoxins, sec3, sec4, seg, seg2, sea, sek2, sel, sel2, sem, sen, seo, sep; serine protease, splA-F; toxic shock syndrome toxin, tsst; panton-valentine leukocidin components S and F, lukS-PV, lukF-PV; methicillin resistance, mecA; penicillin binding protein 4, pbp4; ermA, bleO, addD, tetM, yeeE; alkytmercury lyase, merB; mercury transport protein, merT; mercuric reductase, merA; teichoic acid biosynthesis protein F, tagF.