TABLE 1.

Oligonucleotide primers used for RT-PCR analysis to define the Mb0099-Mb0104 operon

RT-PCR product, gene boundary examinedPlus-strand primer and sequenceaMinus-strand primer and sequencea
1, Mb0098-Mb0099DMC371DMC372
AAGCGGTCCAGGTCGGCATCCTCAAGCCAGGCCAGATAGG
2, Mb0099-Mb0100DMC373DMC613
GAAAGCGGCGTCGGGATACGACCGAGTCCCTCGCCTTTGA
3, Mb0100-Mb0101DMC375DMC376
GCACCACCAAGATCGAGGACGTTCGACCGCGTTGAAGTGC
4, Mb0101-Mb0102DMC377DMC378
TGCTTCGCGGCTGGTCGATCAGCTTTGCACACGCCAGCAC
5, Mb0102-Mb0103DMC379DMC380
GGTCGCATCGGCAGAGCTTGACAGCCTCCAGCTCGCGAAG
6, Mb0103-Mb0104DMC381DMC382
CGCCGTCTGCGACGTGTTGTCAGGTGCTCATCGGCTGACC
7, Mb0102-Mb0104DMC379DMC382
GGTCGCATCGGCAGAGCTTGCAGGTGCTCATCGGCTGACC
8, Mb0104-Mb0105DMC383DMC384
GGTTGCAGCGGTTTGAGGCCCCAGCCGTACCATCGCCATG
9, Mb0105-Mb0106DMC385DMC386
TGGCGCTGGTTACCCAATGGTCTGGGCGTTCGGGTACAAC
  • a Gene-specific primers expected to prime reverse transcription based upon gene annotation are shown in Table 1 as minus-strand primers; gene-specific primers not expected to prime reverse transcription based upon gene annotation are shown in Table 1 as plus-strand primers, except for RT-PCR product 1 (Mb0098-Mb0099), where both primers are expected to prime reverse transcription but not yield a RT-PCR product, and RT-PCR product 9 (Mb0105-Mb0106), where neither primer is expected to prime reverse transcription.