TABLE 1.

Primers used in this study

PrimerSequenceaProduct size (bp)
HtrA-SphI-FWGGACCTCCCTCTGCATGCATAAAGGCTCGA
HtrA-PstI-RVGGAATCTTATTTCTGCAGGCTAATTTTGCTG
PhtrA-SacI-FW2TGTAAATAGCGAGCTCCATTTTCTGA
htrA-SphI-RVGATTATGGTGCATGCAGACTTATTG
Spo0J-flanking-FWGGGTTCTAAGCGCCACATTA
Spo0J-flanking-RVTGAGAAAGTTTTCCACAGGTGA
HtrAspo0J-FWCGCTGACCCTCTTTTTCA
HtrAspo0J-RVTGGGCTGTTTGATGTGGAT
For real-time PCR
    gtfB-FWAGCAATGCAGCCATCTACAAAT98
    gtfB-RVACGAACTTTGCCGTTATTGTCA
    gtfC-FWCTCAACCAACCGCCACTGTT98
    gtfC-RVGGTTTAACGTCAAAATTAGCTGTATTAGC
    gtfD-FWCACAGGCAAAAGCTGAATTAACA83
    gtfD-RVGAATGGCCGCTAAGTCAACAG
    ftf-FWCAGCTAGTACACCGGAAGTAGG124
    ftf-RVGCAATCTTACGAGCCTGTTCTG
    htrA2-FWAAGTTGTTAGACCCGCTCTTG101
    htrA2-RVACCGCTTGTGACATCACTTGG
    spo0J-FWAATCCCTATCAACCTCGACTGC142
    spo0J-RVGCCTTTCTCCTGCAACCAAATC
  • a Italics indicate restriction endonuclease sites.