TABLE 1.

Oligonucleotide primers used in this study

PrimerDNA sequence (5′ → 3′)a
CJ0285FH-FG̅A̅G̅C̅T̅C̅CATACAAGTAAAGGTAATAAT
CJ0285FH-RG̅C̅T̅A̅G̅C̅TATAACCACTCCACGAAGATC
CJ0285BH-FG̅C̅T̅A̅G̅C̅GCTAAAACCTAGAGTTATTAT
CJ0285BH-RC̅C̅G̅C̅G̅G̅CTCTACTAAATCATGGTCGA
CJ0355FH-FG̅A̅G̅C̅T̅C̅AATTCATACACATGCACCCG
CJ0355FH-RG̅C̅T̅A̅G̅C̅TAATGCCGATAAAGTATTCTCC
CJ0355BH-FG̅C̅T̅A̅G̅C̅CTCCAAGAACTTCAGTTATG
CJ0355BH-RC̅C̅G̅C̅G̅G̅CTCTATCTCTATGTTTGAGTT
CJ0643FH-FG̅A̅G̅C̅T̅C̅AAAATTTAAGTTCGGGTGA
CJ0643FH-RG̅C̅T̅A̅G̅C̅CATTAACTCCTTAGCTTCAGC
CJ0643BH-FG̅C̅T̅A̅G̅C̅TGGTGAAGTTGTGGATTATG
CJ0643BH-RC̅C̅G̅C̅G̅G̅GCACTATACCTACCTACAAG
CJ0890FH-FTTG̅G̅A̅T̅C̅C̅TTGCAAAAATGAAAGATGG
CJ0890FH-RAAAG̅C̅T̅A̅G̅C̅TAAAGATATAACTTCATAACC
CJ0890BH-FTTG̅C̅T̅A̅G̅C̅GATAAAACAATCAATATAGC
CJ0890BH-RAAC̅C̅G̅C̅G̅G̅GCTGAGTATTTTTTAAAGTG
CJ1024FH-FAAG̅G̅A̅T̅C̅C̅CAAAAAGAGCAGCGATTACAG
CJ1024FH-RAAAG̅C̅T̅A̅G̅C̅CTTAAAGTAGCATTTCCTGTC
CJ1024BH-FTTG̅C̅T̅A̅G̅C̅TGGTAATATTAGAGAATTAATATCC
CJ1024BH-RAAC̅C̅G̅C̅G̅G̅AACAGGCACTCTAACACAAGTTGC
CJ1118FH-FG̅A̅G̅C̅T̅C̅GTCGTTTGGTATATTTTTGC
CJ1118FH-RG̅C̅T̅A̅G̅C̅CGTGTCCAAGTCTTGTTAGG
CJ1118BH-FG̅C̅T̅A̅G̅C̅TGAAGCTTGGGATTTATTAAC
CJ1118BH-RC̅C̅G̅C̅G̅G̅AAAATTCCACTACCACAACC
CJ1223FH-FG̅A̅G̅C̅T̅C̅AGTATGTGTTCTAAAAGCCA
CJ1223FH-RG̅C̅T̅A̅G̅C̅CTTCATATCCCTCATCGTTT
CJ1223BH-FG̅C̅T̅A̅G̅C̅GGATTTTAGATGTAAAAGTTCC
CJ1223BH-RC̅C̅G̅C̅G̅G̅ACTTCTTCATTGCTAGCATGTC
CJ1227FH-FG̅A̅G̅C̅T̅C̅CCTATTGATCTTAAAAATTATATAG
CJ1227FH-RG̅C̅T̅A̅G̅C̅CCAAATATTCAGCTGTAATTTCTGC
CJ1227BH-FG̅C̅T̅A̅G̅C̅GAATATCAGCTTATCATTTTAGACC
CJ1227BH-RC̅C̅G̅C̅G̅G̅CATTGTTAACCTCAACCCTAGCT
CJ1261FH-FG̅A̅G̅C̅T̅C̅TACAAGAGCATTTATAAGTAAAGTC
CJ1261FH-RG̅C̅T̅A̅G̅C̅ATATTAAATTGCGCTAAATATTCAG
CJ1261BH-FG̅C̅T̅A̅G̅C̅ATGGTCTTGAAGTTTGTAGAG
CJ1261BH-RC̅C̅G̅C̅G̅G̅AAAGAAGAAAGAGTACAAAGCTC
CJ1491FH-FG̅A̅G̅C̅T̅C̅TCATGTAAATATTAATATTGTTTCG
CJ1491FH-RG̅C̅T̅A̅G̅C̅TCCGATTACTTTACTAAAGCG
CJ1491BH-FG̅C̅T̅A̅G̅C̅GGCAAGAGAGATTAAAGAAATTTC
CJ1491BH-RC̅C̅G̅C̅G̅G̅TATAATACCAAGTTGCCCAAATC
CJ1608FH-FTTG̅G̅A̅T̅C̅C̅TGATACCAGAGCAGAATCCTTAAAAAAAGCC
CJ1608FH-RAAAG̅C̅T̅A̅G̅C̅TCATCAAACGAGTTAATAATTTCAC
CJ1608BH-FTTG̅C̅T̅A̅G̅C̅AAATATATTTCCTGATACTGATC
CJ1608BH-RAAC̅C̅G̅C̅G̅G̅GCAAATGGTGATGACAACC
  • a The overlined sequences are restriction enzyme recognition sites. Most of the FH-F primers encode a 5′ SacI site; the exceptions are CJ0890FH-F, CJ1024FH-F, and CJ1608FH-F, which encode a BamHI site. The FH-R primers encode a 5′ NheI site, the BH-F primers encode an NheI site, and the BH-R primers encode a SacII site.