TABLE 2.

Oligonucleotides used in this study

GeneaApplicationPrimerSequence (5′→3′)PrimerSequence (5′→3′)b
HP1326Antisense RNA probe1326-L1GGGTTATGGGTTTAAACGCA1326-R1T7T7-TTATAAATCCAGGCTTGTTT
Promoter HP1326P1326-L1CTTGTTATCTTAATGTAAAG1326-R2TTCACTTCCAAGTCATTAGC
P1326-L2TATTATCCGTTCGCAACAAGP1326-DIGGGTTTGCTCCCATGCGTTTA
P1326-L3AAACACCATTTCCACAATTT
HP1364Mutagenesis, upstream1364-L1GGCAATTAGCGCTACAATACPCAT1364-R11-CTAATCACTAGCATCAACAC
HP1365Mutagenesis, downstreamCAT1364-L12-ACAAGATCACAGAATTAAGC1364-R1CCTATCACGCAGTCTATTAA
Mutagenesis, upstream1365-L1AGAGAGATTATCATAATTGGPCAT1365-R11-CTCCTTAACGCTCTCGCTTA
Mutagenesis, downstreamCAT1365-L12-TTCCACCTTGCGCACTTATA1365-R1GGCGGTGTTGTTGGTTGTCT
Expression in E. coli1365-ASK3-L1TGGTAGGTCTCAAATGAATGCAAAAAA1365-ASK3-R1ATGGTAGGTCTCAGCGCTTAGTGGGTTAAAGCG
AGATTTTTTTACTAGAAGACGATAGCCAAC
Pcatcat gene with promoterCATS1TCCGGTTTTTGTTAATCCGCCCATAS1TTACGCCCCGCCCTGCCA
  • a Gene numbers refer to the H. pylori 26695 genome sequence (32).

  • b The 5′ extensions used for fusion of PCR products to the cat gene by megaprimer PCR are labeled as follows: 1, (5′-GGCGGATTAACAAAAACCGGA), complementary to the 5′ region of the cat gene with promoter; 2, (5′-TGGCAGGGCGGGGCGTAA), complementary to the 3′ end of the cat gene; T7, (5′-CTAATACGACTCACTATAGGGAGA) adds a T7 promoter sequence for creation of digoxigenin-labeled antisense RNA. The BsaI restriction site used for the HP1365 expression via the IBA system is underlined.