TABLE 2.

Primers and probes used in TaqMan real-time PCR analysisa

GeneProbe (5′→3′)Forward primer (5′→3′)Reverse primer (5′→3′)
plyACTCTTACTCGTGGTTTCCGGCGCCAAGTCTATCTCAAGTTCTTCAAAAGCAGCCTCTACTTCATC
hm1CAGACACTGGACCCTGCGGCGCACACCCAATGCCCCCTCGGTTCTTGTCTATCCA
  • a All probes were synthesized with a 5′-labeled 6-carboxyfluorescein reporter and a 3′-labeled nonfluorescent quencher.