TABLE 1.

Nucleotide primer sequences for generation of pNS1/HsfBD1, pNS1/HsfBD2, and pNS1/HsfBD3

PlasmidPrimers
pNS1/HsfBD15′ primer: 5′ GCAGGATCCATTAGCGCGGGTAATAAAG
3′ primer: 5′ GCAGGTACCTTCATTCGATTTAACCAC
pNS1/HsfBD25′ primer: 5′ GCAGTCGACATTAAAGCAGGTAATAAAGC
3′ primer: 5′ GCAGGATCCTTCAAGACCGCAATCCGC
pNS1/HsfBD35′ primer: 5′ GAAGTCGACATTAGTGCGGGTAATAAAGAA
3′ primer: 5′ GAAGGATCCTTCAAGACCATCACCAACTTTGGC