TABLE 1.

Oligonucleotides used

NameDNA sequence
BA440GGGATCACAGGCCAGCATATGGTTG
BA441GAAGATGCTGGGCAGCATGTAATCC
BA961GCTCTAGACAATAGGAACTTCCCTATGTGTCGTCGGCATTTATGT
BA962GAGAGATCTCATTATAGTCATACCAACCTCCCTT
BA980GCGTCTAGAGAATAGGAACTTCCCTCTCGGACTGCCGTACAACGT
BA981GCTCTAGAGAATAGGAACTTCCCATTTGGGTCTTATTACTCTCTG
BA982GAGAGATCTGCGCCGACCAATTTGTACGATCAT
BA983GCTCTAGAGAATAGGAACTTCCCAACGGTGCTGGCATAACAGATA
BA984GCTCTAGAGAATAGGAACTTCCCCGCGGCGCTGGGTCTCATCTGA
BA985GAGAGATCTCAGCGATTCAGAGAGGAATTCGATC
BA988GCTCTAGAGAATAGGAACTTCCCTTAATTTTTAAAGTATGGGCAA