TABLE 1.

Bacterial strains, plasmids, and primers used in this study

Strain, plasmid, or oligonucleotideDescription or sequence (5′-3′)Reference or origin
Strains
    P. aeruginosa
        PAO1chl-2,a otherwise presumed wild type22
        PAO1-JPAO1 lasR sublineNational Food Research Institute, Tsukuba, Japan, via Y. Itoh
        PAO1-DPAO1 lasR sublineDSM, Braunschweig, Germany, via K.-E. Jaeger
        PAO2324met-9020 catA1 nar-9011 tyu-9009 puuD6 hcn30
        PAO6330ΔlasR1 derivative of PAO142
        PAO6379PAO1, nuh::Ω-Sp/Sm; Spr SmrThis study
        PAO6395ΔlasR derivative of PAO1This study
        PDO7recA::Ω-Hg23
    E. coli
        DH5αF endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1 Δ(lacZYA-argF)U169 deoR λ(φ80dlacZΔM15)48
        SM10/λpirthi-1 thr-1 leuB26 tonA21 lacYI supE44 recA chromosome::RP4-2 Tcr::Mu Kmr/λpir31
        S17-1pro thi hsdR recA Tpr Smr; chromosome::RP4-2 Tc::Mu, Km::Tn752
Plasmids
    pBLS-II SKpBluescript cloning vector; ColE1 replicon; AprStratagene
    pHP45ΩColE1 replicon carrying a Ω-Sp/Sm cassette; Spr Smr Apr45
    pME3087Suicide vector, ColE1-replicon; Tcr62
    pME3280aMini-Tn7 gene delivery vector; Gmr Apr69
    pME3827pME6001 carrying lasR on a 1.1-kb PvuI-KpnI fragment; Gmr42
    pME3848pME3087 carrying the lasR gene with an internal 0.36-kbThis study
deletion on a BamHI-EcoRI fragment; Tcr
    pME3872pME3280a carrying lasR+ on a 1.1-kb [PvuI]-KpnI fragment; Apr Gmr7
    pME3873pUK21 containing nuh on a 1.5-kb insert; KmrThis study
    pME3877pME6014 carrying nuh′-′lacZ translational fusion; TcrThis study
    pME3882pME6031 with nuh′-′lacZ on a 3.3-kb BamHI-XhoI fragment from pME3877; TcrThis study
    pME3883pME6010 carrying nuh; TcrThis study
    pME3890pME3087 with nuh::Ω-Sp/Sm on a 3.5-kb insert; Tcr Spr SmrThis study
    pME6010pACYC177-pVS1 shuttle vector; Tcr15
    pME6014Cloning vector derived from pME6010 for translational ′lacZ fusions; Tcr16
    pME6031pACYC177-pVS1 shuttle vector; Tcr15
    pUK21Cloning vector, ColE1 replicon; Kmr61
    pUX-BF13Helper plasmid containing Tn7 transposition functions; R6K replicon; Apr20
Primers
    las1CGCCGAACTGGAAAAGTGGC, upstream of lasR (Fig. 1)
    las2TGAGAGGCAAGATCAGAGAG, downstream of lasR (Fig. 1)
    LG1AGTGAACCCGGGGACCAGGTGTG, with an underlined XmaI restriction site, upstream of lasR (Fig. 1)
    LG2ATCGAGAATTCGCCAGCAACCG, with an underlined EcoRI restriction site, in lasI (Fig. 1)
    LG3TTTAGATCTCGTGCTGCTTTCGCGTC, with an underlined BglII restriction site, in lasR (Fig. 1)
    LG4AAAAGATCTCCCGCCGCGTAGCGGC, with an underlined BglII restriction site, near 3′ end of lasR (Fig. 1)
    P1-KpnIAAAAGGTACCTCGACCTGGCCGCCCTGATCG, with an underlined KpnI restriction site, upstream of nuh
    P2-HindIIIAAAAAAGCTTCGCGGTGCTGGCCAACCTGA, with an underlined HindIII restriction site, downstream of nuh
    P3-BamHIAAAAGGATCCTCGACCTGGCCGCCCTGATCG, with an underlined BamHI restriction site, upstream of nuh
    P4-PstIGTTTCTGCAGCGGACAGAGGAAGGCT, with an underlined PstI restriction site, annealing to the first 8 codons of nuh
    Tn7-1AACATGGCCAAGTCGGTCACC-3, in glmS downstream of the Tn7 attachment site
    Tn7-3CCAGCCCGGTCGTAATGCTC, in lasR
  • a chl-2, spontaneous chloramphenicol resistance.