TABLE 1.

Oligonucleotide primers for RT-PCR microarray validation

GeneForward primerReverse primer
fetAATCCAACACCAATTTGGCGTACCATCGGCGGAATAGCGTTT
hemOGAAACTGCAATCCGTGTTCCACATCGTATCGCGCCATGTATT
tbpAAGACACTTGGGCGGATTATGGAACAGTGCGTCTGCTGAAA
tbpBTGGATGCGGTTGAATTGACAGGACAGGAGCGGAATCATAATG
cahGGCGTATCATGGTTGGTGTTGCACGTGCATTCAGAGGCTGTAC
L11TGATGGAACACGGTGCACTCTTGCTGCCAGATTTGTTCGGT
NGO0295GCGGTTTATCGGCATTCTGATCTGCCTGATTTTCGGTGATGTT
NGO1246TCTGCCGAAACGCAAAAATCAAAGCACCGCCGTAATCTCA
secYTGGTGCCCATATACCCGTACCTTCTAACGACCCACCGGAAAAC
NGO1996TATCCCGTTGTGCAGATGTCCATATGCCTGCCCTGTATCCGT
porITGTCCGTACGCTACGATTCTCCAGCCAACGTGGTAAGATTCGC
NGO0021GGCAGATACAGGCAGGCTACGGTAGGCGGTGAAGAGTTTG
NGO0553AAAGACGACAGGCAGCTGATGCCGTCTGTAATGTCGGTTT
NGO0952GATCAGGACAACGGGCTTTAGCCCTTTATCGCCCTTAAAC
NGO1205TCAACGCAAGAACTGTACGCCCGACTTCAAAGGTGTTGGT