TABLE 2.

Primer and probe sequences used in Q-RT-PCR assays

GeneAccession no.aForward primer (+) and antisense primer (−)Probe (5′FAM)b
gyrBNC003997.3:4584-6506(+) ACTTGAAGGACTAGAAGCAGCGAAAACGCCCTGGTATGTATA
(−) TCCTTTTCCACTTGTAGATC
atxANC001496.1:150042-151469(+) ATTTTTAGCCCTTGCACCTTTTATCTCTTGGAAATTCTATTACCACA
(−) AAGTTAATGTTTTATTGCTGTC
acpANC002146.1:68909-70360(+) ATTATCTTTACCTCAGAATCAGCAATTTCTGAAGCCATTTCTAATCTT
(−) AACGTTAATGATTTCTTCAG
acpBNC002146.1:49418-50866(+) TTTTTCAATACCTTGGAACTCTTGAAGAATCATTAGGAATCTCATTACA
(−) AATGCCTTTTAGAAACCAC
capBNC002146.1:56089-57483(+) TTTGATTACATGGTCTTCCATAATGCATCGCTTGCTTTAGC
(−) CCAAGAGCCTCTGCTAC
  • a Each accession number is followed by the version number and the nucleotide region for that sequencing project.

  • b FAM, 6-carboxyfluorescein.