TABLE 2.

Primers used in this study

PrimerSequence (5′-3′)a
WCFS-lamA-NdeIcagtgattcatatgTTGACCGGATGTTATCCAG
WCFS-lamA-EcoRIcatgaattcATTGGACAAGCACTTGCGACG
WCFS-lamA-KpnIacgggtaccTTAGTAATGATTTGCCG
WCFS-lamA-BamHIaatggatccAGATCATTTGGCGAGTTTAG
pBAC-SacB-EcoRIcgtgaattcTACACTGACTATTCCG
pBAC-SacB-KpnItcaggtaccGTGTTTGAAGTGATCAGC
Lam-NdeI-junction-1GTTAGGCCAAGTTACTTTGC
Lam-BamHI-junction-4CTACGCTTATTGGTACGAGC
SacB-control-2CATCGATAAACTGCTGAACG
SacB-control-3CGATGCTGAGTTAGCGAACG
RR-lamA-FGCAGGCGACTTCCTTGAAAC
RR-lamA-RGAAGCGAGTATCTCAGAATG
LamBD-NICE-KpnICTAGGTACCTTATTTACGTAGTTCGTC
LamBD-NICE-NcoIGGAGTGGGCCATGGAAAAGCCAGAAC
pNZ8048-FGTTAGATACAATGATTTCGTTCG (left of MCS)
pNZ8048-RCAATTGAACGTTTCAAGCCTTGG (right of MCS)
Lp1197-2FbGACAAGCACGACCAACTCACA
Lp1197-2RbTAAGCCGACAACTAGCCCAATCAA
Lp1204-1FbACGTCATCCATTTCGCTTTTT
Lp1204-1RbGTCTCATTCCACGCATCTCTGT
Lp3581-2FbGATTGGCCTATTTGTCATT
Lp3581-2RbGAGCTTCGATTTCATTCA
  • a Nucleotides homologous to nucleotides in the genome sequence are shown in capital letters, nucleotides in the restriction enzyme recognition sequence are shown in bold type, and nonhomologous nucleotides are shown in lowercase letters. Mismatched nucleotides are in italics; the start codon of LamBD is underlined. MCS, multiple cloning site.

  • b Primers used for real-time PCR.