TABLE 3.

Primer sequences used in primer extension and nonquantitative PCR assaysa

GenePrimer namePrimer sequence (5′→3′)
acpAMD28CTGTTTGTCATGTAAATAATTCTT
MD33AGAAATGGCTTCAGAAATTG
MD34TCGGCTAATATCTTTTTCCAT
acpBMD62TGTAAACCATTTTTCTTCGC
MD64TCCCTTGCTTTTAAGAATGT
MD65GTCAGAATCCCTGGTTTGTA
MD108GATTCAGCAGTGTTTCCAAT
MD129AGGCCTTAATTAAAGACGAGA
capBPE2CCATTTCTATACTAGATGTTGCATG
  • a DNA oligonucleotides were purchased from Integrated DNA Technologies (Coralville, Iowa). PCRs were performed using a PE-Applied Biosystems (Norwalk, Conn.) PCR system 9700.