TABLE 1.

Oligonucleotides used in this study

NameSequenceProduct and/or usea
MX565′ ACATACACTTCACCACATTGATGTAT11
MX575′ CCTTGATCCCTCGTATTCAACTTCT p7557/T1
MX645′ CCGGGTTTTTCAGTTCTGTAATGCCp.e.
MX755′ CATCGCTTATCTCAACGTCGTCACAG p7557
MX775′ GGGAGGGGTATCCCTCAAATCTGTp.e.
MX805′ CATTATTATACAGAAAGATTTAAATAGTACCTCCGTG p8081/T7
MX815′ CACGGAGGTACTATTTAAATCTTTCTGTATAATAATG p8081/T7
MX825′ CATTATTATACAGACAAGATTTGGATAGTACCTCCGTG p8283/T2
MX835′ CACGGAGGTACTATCCAAATCTTGTCTGTATAATAATG p8283/T2
MX845′ ATAGTACCTCCGTGTATCCGTACTTTGTGGATACAGAG p8485/T3
MX855′ CTCTGTATCCACAAAGTACGGATACACGGAGGTACTAT p8485/T3
MX865′ GGTGAAGCATATGTGGAAGCAGATAAAGCACAGA p8687
MX875′ ACCGAAAGCTTTCCGTATATTGAGACCCTCTTGACGCC p8687
MX915′ CTTCACCACATTGATGTACATTATTATACAGACA12
MX925′ GTCTGTATAATAATGTACATCAATGTGGTGAAGA12
MX935′ ATTATACAGACAAGATTTAAATAGTACCTCA23
MX945′ GAGGTACTATTTAAATCTTGTCTGTATAATA23
MX955′ AAGATTTAAATAGTACCTCCGTGTATATGTACA34
MX965′ GTACATATACACGGAGGTACTATTTAAATCTTA34
MX975′ TTTGTGGATACAGAGGTGATATGCATGTACAGGAA50
MX985′ TCCTGTACATGCATATCACCTCTGTATCCACAAAA50
MX995′ CGGGGCCACATTGATGTACATTATTATACAGACA15
MX1005′ GTCTGTATAATAATGTACATCAATGTGGCCCCGA15
MX1015′ CTTCACCAGGGGGATGTACATTATTATACAGACA16
MX1025′ GTCTGTATAATAATGTACATCCCCCTGGTGAAGA16
MX1035′ CTTCACCACATTGATGGGGGTTATTATACAGACA17/T8
MX1045′ GTCTGTATAATAACCCCCATCAATGTGGTGAAGA17/T8
MX1055′ CTTCACCACATTGATGTACATTATTAGGGGGACA19
MX1065′ GTCCCCCTAATAATGTACATCAATGTGGTGAAGA19
MX1115′ GCACTCCCCTTGAGAATACCCTTGGCAGT10
MX1135′ GATGTACATTATTATACAGAGAAGATTTAAATAGTACCTCCGTGTATATGTACTTTGTGGT4
MX1145′ CCACAAAGTACATATACACGGAGGTACTATTTAAATCTTCTCTGTATAATAATGTACATCT4
MX1155′ GATGTACATTATTATACAGATAAGATTTAAATAGTACCTCCGTGTATATGTACTTTGTGGT5
MX1165′ CCACAAAGTACATATACACGGAGGTACTATTTAAATCTTATCTGTATAATAATGTACATCT5
MX1175′ GATGTACATTATTATACAGAAAAGATTTAAATAGTACCTCCGTGTATATGTACTTTGTGGT6
MX1185′ CCACAAAGTACATATACACGGAGGTACTATTTAAATCTTTTCTGTATAATAATGTACATCT6
MX1245′ GTACATATACACGGAGCCCCTATTTAAATCTTT9
MX1285′ GTACATACCGCCGGAGGTACTATTTAAATCTTB16
MX1295′ CTTCACCACATTGATGTACATTAATATTATACAGACA13
MX1305′ GTCTGTATAATATAATGTACATCAATGTGGTGAAGA13
MX1315′ CTTCACCACATTGATGTACATTTATACTGACA14
MX1335′ GTCAGTATAAATGTACATCAATGTGGTGAAGA14
MX1385′ CAAGAACGATCTTATTCATCATATCACCp.e.
MX1395′ TCCCCCGGATTCTCCCTGCAATTATCCTTGT10
MX1405′ CTTCACCACATTGATGTACATCGGTATACAGACA18
MX1415′ AAGATTTAAATAGGGCTCCGTGTATATGTACT9
MX1425′ GTCTGTATACCGATGTACATCAATGTGGTGAAGA18
  • a The DNA molecule or plasmid generated using the oligonucleotide as a PCR primer or as one partner in a pair of complementary oligonucleotides, p.e. identifies DNA molecules used for primer extension mapping of transcript start sites.