Bacterial strains, plasmid, and oligonucleotides used in this study

PCR componentGenotypeAntibiotic markeraDescription or sequenceSource or reference
    EL59 S. pneumoniae R6Avirulent, unencapsulated starting parent strain derived from serotype 2 strain D39 21; A. Tomasz
    EL1454EL59 kan-t1t2-Pc-pcsB+KanrEL59 transformed with linear mreD-[kan-t1t2-Pc]-pcsB+ amplicon 42
    EL1472bEL1454 ΔvicR<>ermAMKanr ErmrEL1454 transformed with linear ΔvicR<>ermAM 42
    IU1545EL59 PfcsK-pcsB+KanrEL59 transformed with linear PCR amplicon mreD′-[kan-t1t2-PfcsK]-pcsB+-′rpsB 41
    IU1602IU1545 ΔvicR<>Pc-ermAMKanr ErmrIU1545 transformed with linear PCR amplicon ΔvicR<>Pc-ermAM 41
    EL27 E. coli BL21(DE3), pLysS (pSP001)Ampr Cmr E. coli strain for overexpression of His10-VicRThis study
Plasmid pSP001pET-16B containing full-length vicR; expresses His10-VicRThis study
    WN206ATGAAGGGAATCACAGGATTCAAGCGTT; forward primer (spr1875)
    WN208AAATGACAAGGCTACTGTTGACGCTAAT; reverse primer (spr1875)
    WN209AGGGGCTTGGCTTTAATTGTGGATGAA; forward primer (spr0096)
    WN210GCAGCTACTCCTGCAAGAGTTGCTTTA; reverse primer (spr0096)
    WN212AGAAACCATTACTGTACTTAATAAA; reverse primer (pcsB)
    WN213AATAGCTGATACTTGCTCCTGAATT; reverse primer (pcsB)
    WN214TTAGGCCTTTTTTTGGTATACTAGTA; forward primer (pcsB)
    WN235TTGAAAGGGGCAAAAGTAGTATCTT; forward primer (pspA)
    WN236TAGCGACGCTGGCTAGACTTGTTAA; reverse primer (pspA)
    WN253CACATTTCTCCAAAATCAGCCATGCTT; forward primer (spr0709)
    WN254AATGAGGAAGCTGCTGGTTTAATTCTT; reverse primer (spr0709)
    WN256CTGGAGCCTTACCGATGACATCAAT; reverse primer (fabR)
    WN259dAGTCTATAGCTTGGTACCGACGAT; forward primer (pcsB)
  • a Antibiotic resistance markers: Kanr, kanamycin; Ermr, erythromycin; Ampr, ampicillin; Cmr, chloramphenicol.

  • b vicR reading frame replaced in-frame by the ermAM reading frame.

  • c Used for preparation of DNA fragments in band shift and footprinting assays. Positions of primers used for PCR are indicated by arrows in Fig. 5, 6, and 8.

  • d Primer WN211 or WN259 was used with primer WN212 to generate PCR amplicons used in band shift (Fig. 5) or footprinting (Fig. 9 and 10) assays, respectively.