TABLE 2.

Primers used to detect ETT2 genes in E. coli strains

Primer designationSequenceTarget genes in O157:H7Region designationResulting product length (kb)
3715F5′ GCCGGGTTTGTATCGTGCCTTTTC 3′eprK-epaSA5.4
3722R5′ TGCCGTTATGCTGGGTGGTGAG 3′
3721sF5′ CCGATTTCCTTTGCATATTTCC 3′epaR-epaOB2.7
3727R5′ ATGCCAATGTGCGCGAAAATGAAT 3′
3726F5′ GCGCGCCATTTACACGTATCTCTA 3′eivJ-eivIC2.7
3730R5′ TGGCGACAACCGTGGCAGAGTATT 3′
3730F5′ CCGCGTCATTGAGTCGATAAAAAG 3′eivC-eivFD1.8a
3735R5′ GGCCGCTTAGTCTCATTCCTTCC 3′
  • a This is the region containing the deletion, as PCR with the same primers on a template of the O157:H7 genome is expected to result in a product of about 6.8 kb.