TABLE 1.

Oligonucleotides and PCR conditions used for RT-PCRs

Primer designationSequenceAnnealing temp (°C)Elongation time (s)
3716F5′ GCCGCACAACAGCAGGATAAAC 3′5930
3718R5′ TCCGACCCGAAATTCCTTGC 3′
3722F5′ CGGGGCTTGCGTAAACGATAGTA 3′6350
3725R5′ TCGCGATGGACGGTTGGACAATGT 3′
3720F5′ ATGCAAGTCTTTTCCAGTGATGTC 3′5230
3720R5′ TCAACTTTCTCTTACGCAAGATTG 3′