TABLE 1.

Primer sequences and their corresponding plasmid coordinates

PrimerPrimer sequence (5′-3′)aPlasmid (coordinates)
BBL1FCATTATCACAGGAGCTTGCTAGGCcp32-8 (81-840)
BBL1RTCCTAGTCCTTTAGCCTGCTCATTcp32-8 (999-1022)
BBL4FACGCGGCGTTAAACTTGTTCCAcp32-8 (2931-2952)
BBL4RACCTCCGGCCTTGATAATAACACCcp32-8 (3133-3156)
BBL7FGCTTACAAGCACAAGTTGCAGGAGcp32-8 (4958-4981)
BBL7RTGGCAGCCCATATGGTAGAAAGTcp32-8 (5155-5177)
BBL11FGGAGATGCGTCAGATGATGGACTTcp32-8 (7079-7102)
BBL11RCAGCGGCATGCCATAAGGATTTACcp32-8 (7310-7333)
BBL15FGCTATGAGTAAAGTTGGAGGAGGCcp32-8 (9418-9441)
BBL15RGCTGCTCATAGCACCACTGGATTTcp32-8 (9700-9723)
BBL16IFAGAAAGAAATCAGGGAGATTACTCGcp32-8 (10386-10410)
BBL16IRGATGAGCGTCAAAGCGTAGCATAGcp32-8 (10731-10754)
BBL17FCAATCGCGAATTGGCAGGCAAAGAcp32-8 (11350-11373)
BBL17RGCCCATAGTCTTCTAATGCCTCGTcp32-8 (11634-11657)
BBL18RCGGTTGCTATTTTTAAGCTTGATTCGcp32-8 (12402-12427)
BBL20IFAGCACAACTTACAGTGCGGTTCcp32-8 (13079-13100)
BBL20IRTGTCTCCCTCAAGTAAAGTACCACTcp32-8 (13274-13298)
BBL21IFGCACTGACGAGTCATTTAGACTGATcp32-8 (13968-13992)
BBL21IRGATGCAGCATATCCCGGCTTCTTTcp32-8 (14149-14172)
BBL22IFTGCCGAAGAACTTGCAGCTGATcp32-8 (14548-14569)
BBL22IRGCTGCCATAAGCAAGATTTGATGGTcp32-8 (14779-14803)
BBL24IFTGTTGAGCTTGGACTTACGTCTTcp32-8 (15442-15464)
BBL24IRCATTTAATGGAGCGAGTGCCGCATcp32-8 (15621-15644)
BBL28FATGCTAAACGGCTGTAATTCTAATGATcp32-8 (17244-17270)
BBL28RAATTCTCCAGCATCAGTTAAAGCGGcp32-8 (17428-17452)
BBL1QFGAGTGCTGCCCACAATGTTAcp32-8 (197-216)
BBL1QRCCAATCCCATGAAAACGGTAcp32-8 (282-301)
BBL6QFATGCCCGAGCAGATAAAAGAcp32-8 (4443-4462)
BBL6QRAATTCGTCGCCCAGTTCTAAcp32-8 (4533-4552)
BBL17QFCCCTTAGACTTCACCGACGAcp32-8 (11162-11181)
BBL17QRACCCGGATAATCAGTGCTCAcp32-8 (11277-11296)
BBL23QFTGATTTTTGTAACAGTGCTGGTTTcp32-8 (15279-15302)
BBL23QRTGTGATTTTTGCCATTACCAcp32-8 (15382-15401)
L27QFTGGAACAACTAATAGCACAAGATTTcp32-8 (16618-16642)
L27QRAGTGTTAAGTTCATTTTTGACACCAcp32-8 (16742-16766)
L28QFTGGAAAAGAAAATGGGGATGcp32-8 (17531-17550)
L28QRTAGTTGCATTGCTTGCACCAcp32-8 (17612-17631)
L29QFAAAGCACAATTTGGAGCTTGAcp32-8 (18499-18519)
L29QRGGAATTCGCGTATCAAAAGAAcp32-8 (18385-18405)
L35QFGCGTAGAAAAGAGTTTGCAAAAAGcp32-8 (22507-22530)
L35QRTGGACCTAGAATTGCTGCTGcp32-8 (22627-22646)
L38QFTGACCCCAAAAGCTATCAAAAcp32-8 (25762-25782)
L38QRCCCCTACACCCACTTATTGCcp32-8 (25674-25693)
L39QFTGATGAGCAAAGCAATGGAGcp32-8 (26459-26478)
L39QRAAATCTCCTAAGTCTGCCCAGTTcp32-8 (26547-26569)
L42QFCAAAAGTGGGAAAGTGGAGAAcp32-8 (29090-29110)
L42QRGCTCTACATCCAATTCGCTTCcp32-8 (29211-29231)
L43QFAGGGGAAGTAATTCGGCACTcp32-8 (30010-30029)
L43QRTAGTTTCTTGCCCGCATCTTcp32-8 (30093-30112)
Fla FTTCATGTTGGAGCAAACCAAFlagellin (524-543)
Fla RCTGAGCAGTTTGAGCTCCCTFlagellin (602-621)
L42P1AGACCGCTCTACATCCAAcp32-8 (29219-29236)
L42P2CCGTTAACAACACTTTCTCCACTTTCcp32-8 (29099-29124)
L42P3GTTAACAACACTTTCTCCACTTTCCCAcp32-8 (29096-29122)
AAPGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIGAbridged anchor primer
AUAPGGCCACGCGTCGACTAGTACAbridged universal primer
L1EKF GACGACGACAAGATGTGTGATTTAAGAAAAAC AAAACTAcp32-8 (67-92)
L1EKR GAGGAGAAGCCCGGTCAAAATGAGAATAATTTCTCTTTTAAcp32-8 (1263-1289)
L6EKF GACGACGACAAGATGGAATTATTTGATGAAAATTATTATGcp32-8 (3963-3990)
L6EKR GAGGAGAAGCCCGGTTAACTTTGCTTTATGTTAACTTGCAcp32-8 (4897-4922)
L11EKF GACGACGACAAGATGCCGCAAGATACAATTAGTGTAcp32-8 (6702-6724)
L11EKR GAGGAGAAGCCCGGTTAAGCACTTAAGCTGTTTTGATAATCcp32-8 (7787-7813)
L17EKF GACGACGACAAGATGCTGTTACTACAATATGATTTTAAcp32-8 (10952-10977)
L17EKR GAGGAGAAGCCCGGTTATTTTTTACGTTTTGTATTAGAATCcp32-8 (11876-11902)
L23EKF GACGACGACAAGATGGATACTATTAAATTAACCGAACTcp32-8 (15215-15240)
L23EKR GAGGAGAAGCCCGGTTAATCTCTTTTTTTAATGTGATTTTTGcp32-8 (15391-15418)
  • a Tail sequences that allow ligase-independent cloning into the pET32Ek/LIC vector are indicated by underscoring.