TABLE 2.

PCR primersa

Primer nameSequence
ydbR_P1GGTACGGGAACGCATAATGATTATC
ydbR_P2CTCCTTGCATGCACCATTCCTTCTGCCCTTTAGACAAGAAGGAC
ydbR_P3TTCTAGGATCCCAACCGTGATCTCAAACGATCGCCGTTCTTCAG
ydbR_P4AAAGATTTGCTGGACAAGGCCC
yqfR_P1GCCGTAATCAAACGGCTCTATTC
yqfR_P2TCATCAACATCTACACCGCCATAAAGCTCCTTAAAGCGACAATTATG
yqfR_P3GGAGGTGTAGCATGTCTCATTCGAAAAGAAAGTAGGGGAACCTGTTG
yqfR_P4GAGACGATTACATCGAAAGAAACA
5′kan783(SpeI)TATACTAGTTGAATTCGATAAGCTTGCAT
3′kan783(SphI)IIAAAGGATCCTATTCTCAGCAACAGGTTC
yqfR5′pX(SpeI)AAAACTAGTAGGAGGTGGGAAAAATGAAAGAAACGA
yqfR3′pX(BamHI)AAAGGATCCTATTCTCAGCAACAGGTTC
5′ydbRpSG51(HindIII)TTAAAGCTTAAATCGGACAAGATAAACGTG
3′ydbRpSG51(EcoRI)TATGAATTCTCCGTAAGATTTTTTCTGGCGTCT
5′yqfRpSG51(HindIII)TTAAAGCTTGAGGCACTGATAAACAAAAAT
3′yqfRpSG51(PstI)TATCTGCAGTCCCTTTCTTTTCTTAGATTGGTTTC
KH44TATGGGCCCATATATCATTGCAACTGACCT
KH45TATGAATTCACCACCACCCTTTCTTTTCTTAGATTGGTTT
KH42TATGGGCCCTTGTTCGAACTATCTTTAAGA
KH43TATGAATTCACCACCACCCGCTTCTTTAGTAACGTTAG
L1upTGAGGGCCCGTGGAGCAGTTGTGCTTCC
L1dwTAGGAATTCTCCCCCTTTTACGTTAAAAGTTGAAGAGTC
  • a Restriction enzyme recognition sites are bold and italic.

  • b Sequences overlapping with resistance cassettes are underlined.