TABLE 2.

Primers used in this study.

PrimerSequence (5′ to 3′)
Primers used for ybcQ and ipeX cloning and ipeX mutagenesis
    ybcQ
        ForwardTCTGGCTGGATccTGCTCAGGTCG (BamHI)
        ReverseGCACTGATGAatTCGTTGCTGTAGG (EcoRI)
    ipeX
        ReverseCCGGTTAGAGATGGATccCGTTG (BamHI)
        ForwardGCACTGATGAatTCGTTGCTGTAGG (EcoRI)
            SL-1CTAATCgaATTcCGAAAAAGATATGTTGCGGGAGGCG (EcoRI)
            SL-2gGaattcGCCTCCCCAACATATAAGTGGC (EcoRI)
            SL-3CCCTCAAGCgAaTTCCTTTAGAAGC (EcoRI)
    ipeX SL-2 mutantCCCCAACATATAAGTGGCTCaaaCAAGCCACTTCCTTTAGAAGC
Primers used to construct ompC and ompC-phoA clones
    ompC
        ForwardCTTGcATgcTTATTGCTTGATGTTAGGTGC (SphI)
        ReverseCTTtCATGATATTAACCCTCTGTTATATGCC (BspHI)
            SSAACTTcaTGAGCGTTTGCTGCGC (BspHI)
            WholeATCCtCATGAGAACGGTCGCAAGAG (BspHI)
    phoA
        Forward
            SSAAATAtcaTGAAACAAAGCACTATTGCACTGGC (BspHI)
            BspHIacatcAtGaaCGGACACCAGAAATGCCTG (BspHI)
        ReverseCGAAgcTTCACTGCCGGG (HindIII)
Primers used in RT-PCR analysis
    ipeX
        Forward (RT)CCCTCAAGCgAaTTCCTTTAGAAGC (EcoRI)
        ReverseCCGGTTAGAGATGGATccCGTTG (BamHI)
    ipeX-SL-4 reverseGGGTAATATATAACAGAAGGTTTATATAG
    lc
        ForwardGGTCTGAACTTTGCTGCTCAGTACCAAGGC
        ReverseCTGGTAAACCAGACCTACAGCAAC
    ompA
        ForwardGCTATCGCGATTGCAGTGGCAC
        ReverseCTGGAGCCGGAGCAACTACTG
    ompC
        ForwardCGGTAAAGTAGACGGCCTGCAC
        ReverseCTGGTTGTCGTCCAGCAGGTTG
  • a Restriction sites are underlined and mutational sites are in lowercase letters.