TABLE 2.

Primers used in this study

Primer nameLocationPrimer sequence
PS25chrICTGCTCTAGACAACGAAGAAGCTCAGCTCGCTCTGCATGC
PS26chrIACTACGAGCTCGGACTCATCAGGTTCATCACCCC
PS27chrICGAGTACTTAATTCAAGGGCGTGATATCGC
PS31chrICCACTATACAATTTTGTGAGTTCTTATACG
PS28chrIICTGCTCTAGAGACACGGAAAATATCGGAGATCATCCGCCC
PS29chrIIACTACGAGCTCCCTACTGCATGAGCTGCGTCAAGGTGTGC
PS30chrIIGGCCGCTACTGCAGAGATGATCACCGCACGGTACCG
PS32chrIICACTACCCAGAAAGATTGAAAGAGCGTTACC
PS33BR8701CGCCCAAGCTTGGCGACCAACAATACTCAACAACTACG
PS34BR8701TAGAAGGCCTCCCAGCTCATTCCTCCCAGCAAACC
PS35chrIIAAAACTGCAGGGCGGGCGTTAGCCATTTGGGAGAAC
PS36chrIIACATGCATGCCCTAACGGCGAAACGGTTGTGCTCG
PS37KanCAGTCATAGCCGAATAGCCT
PS38KanCGGTGCCCTGAATGAACTGC
PS43AmpGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAG
PS44AmpGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACC
RAF76lacICGAGGGCTAGCAGGAAACAGCTATGAAACCAGTAACGTTATACGATG
RAF58λcITGCATTGATGCCATTAAATAAAGCGCTAACGCCTGACTGC
RAF70araETTCCGCCTCAATATGACG