TABLE 3.

DNA primers used

Primer nameNucleotide sequence (5′ to 3′)
(fliC)Eco3EGGGGAATTCTTAACGCAGTAAAGAGAGGA
(fliC)SmaIEGGGCCCGGGACGCAGTAAAGAGAGGACGT
(fliC)SmaISGGGCCCGGGTAAAGTTCGAAATTCAGGTG
(fliC)S1(Sph)124GGGGCATGCTAAAGTTCGAAATTCAGGTG
CifBiSaGGGGGAGCTCACGGTGAGAAACCGTGGGCA
CirBi2SpGGGGGCATGCTTAACGCAGTAAAGAGAGGA
FLIC1GGCCATGGCACAAGTCATTAATACAAAC
FLIC9GGGGATCCTTAACGCAGTAAAGAGAGGA
ICE4BGGGGGATCCCTTCAGTGGTCTGCGCAATGG
ICf1BgGGGAGATCTCTAAAGTTCGAAATTCAGGTG
ICiPr1BmGGGGGATCCACAAAAATATAAGGTCAGGGA
ICiPr2EcGGGGAATTCTTTCGTAGTAGTATTAATACTTAT
ICmt1AATGACTTGTGCCAGGATCTTTTCC
ICmt2GGAAAAGATCCTGGCACAAGTCATT
ICr1EGGGGAATTCTCAACAGCGACAGGCTGTTTG
ICS3EGGGGAATTCACGGTGAGAAACCGTGGGCAA
JAf2BGGGGGATCCGAATGTATAGCTGTAAATGAT
JAr1SGGGGTCGACTTATTCAGCGTAATCCGAAGA
JBPr1BmGGGGGATCCGAAAGCGTATGATGTGAAAGA
JBPr2EcGGGGAATTCACTTGTGGTTTTAGCTTTAAT
PTRCP7GGGGAATTCGCAGCAGATCTGGTTTG
TRCf1SaGGGGAGCTCAATTGTGAGCGGATAACAATT