TABLE 1.

Primers used in this study

PrimerSequence (5′ to 3′)aPurpose(s)
CovR R4ACGCATGAAAACACCTCAGTTCTAAGACTCCovR inactivation
Bam-CovR F4ccgcggatccATTAATGAAGTTTTTGTCGAAAACACovR inactivation covR complementation (pIB30), Pcov-gusA fusion, RNA blotting
Bam-CovR R2gcgcggatccTTAATTATTTTCGCGAATGAATACCCCATGCCcovR complementation (pIB30), MBP-CovR expression (pIB7)
Eco-CovR F2gcgcgaattcATGGCTAAGGACATTTTAATTATTGAAGATGMBP-CovR expression (pIB7)
Xho-CovR-R5cgcgctcgagATCGAAATCTTTTTCAAGTGCTCPcov-gusA fusion, RNA blotting
CovR Fout 2AACCTCATATCCTTCATGTTGTAATTCTAAAGPcovR primer extension
CovR Fout 4GGGAAACTCCTTACGTTACTAAGGPcovR primer extension
Bam-GtfB F2gcgcggatccACGTATTCGTGATAAGAAGAAACGTPgftB-gusA fusion
Xho-GtfB R2cgcgctcgagCCACCCGAAAGTGTAGTTAAAGTCAPgftB-gusA fusion
Bam-GtfB F3gcgcggatccAAGTAACTAACTCGTCGTTTCATTGCGtfB EMSA, DNase I protection assay
Xho-GtfB R3cgcgctcgagTTTGCGCAGTTTATAACGCACTTTCGtfB EMSA, DNase I protection assay
GtfB Fout3CACAGCAGATGCAACAGATACTGTCACCCATCPgtfB primer extension
Bam-GtfC F1gcgcggatccTAAGAGGGCGTTTCTAGGGTTAGGAGGtfC EMSA, DNase I protection assay, PgftC-gusA fusion
Xho-GtfC R1cgcgctcgagAGGTCAAAGTCACTACAGCTGAAGCGtfC EMSA, DNase I protection assay, PgftC-gusA fusion
GtfC-Fout 1GATACTGTCACCCATCTTTTCTTTACTTTACGPgtfC primer extension
Smu-RpsL FATGCCTACAATTAACCAGTTGGTTCGTAAGCCRpsL RNA blotting
Smu-RpsL RGGTTTCTTAGTACCCATATTTAGAACGGCCRpsL RNA blotting
Smu1405 R SaccgcggagctcCCAACCAGTATAATGACGTCTTTCCAGCpIB105 construction
Smu1405 FGTATGATAGTATCCTTTTATCAGGGpIB105 construction
  • a Lowercase letters indicate restriction sites incorporated into primers.