TABLE 2.

Oligonucleotides used for this study

PrimerSequence (5′→3′)aPurpose
RT-rpoD-FGATCCGGAACAGGTGGAAGACRT-PCR of rpoD
RT-rpoD-RTCAGCAGTTCCACGGTACCCRT-PCR of rpoD
RT-mexX-FCATCAGCGAACGCGAGTACACRT-PCR of mexX
RT-mexX-RCAATTCGCGATGCGGATTGRT-PCR of mexX
RT-PA5471-FACAGCACCTGGATCGAAGGCRT-PCR of PA5471
RT-PA5471-RTTCGATGCAGTCGCTCCAGRT-PCR of PA5471
RT-PA5470-FGATCCTGCTGCAACTCTCCGRT-PCR of PA5470
RT-PA5470-RACCAGTTCTTGCGCGCATRT-PCR of PA5470
RT-mexZ-FAAACCCGCGACGGCATACTRT-PCR of mexZ
RT-mexZ-RACTGGCGGAGAAAGCCCATRT-PCR of mexZ
E-PA5471-FGCTAGAATTCGATCTACCGTTTCAATCACATGGAT; EcoRIPCR cloning of PA5471
X-PA5471-RGATCTCTAGAGGCCACCTCCTCGATTACCT; XbaIPCR cloning of PA5471
EH-mexX-FGAATTCAAGCTTCAAGCTCGCGAGTTCACGA; EcoRI, HindIIIPCR cloning of mexXY
N-mexX-RACGTTGGACGAGGCGATCTCPCR cloning of mexXY
mexZ-FTCGTGAACTCGCGAGCTTGPCR cloning of mexZ
mexZ-RCACATCAGCGAGGAAGACGCPCR cloning of mexZ
PA5471DU-FGATCAAGCTTCCTGGGAAGGCTATACCAACGbDeletion of PA5471; upstream fragment
PA5471DU-RGCTAGGTACCGCCCATAATCCAATCCATGTGb; KpnIDeletion of PA5471; upstream fragment
PA5471DD-FGCTAGGTACCCGGAAGCCGGTGCTGACCTACA; KpnIDeletion of PA5471; downstream fragment
PA5471DD-RGCTAGAATTCGCTTCATCGGCACCATCAT; EcoRIDeletion of PA5471; downstream fragment
XPA5470-FGATCTCTAGATGCTCGACATCAACCACAACCDeletion of PA5471-PA5470
PA5470-DDRGCTAGAATTCCCAACGACGCCTTCTACTAC; EcoRIDeletion of PA5471-PA5470
mexZDU-FGATCAAGCTTAATTCGCGATGCGGATTG; HindIIIDeletion of mexZ; upstream fragment
mexZDU-RGATCTCTAGACACTGAACGTCCTCACAAGGG; XbaIDeletion of mexZ; upstream fragment
mexZDD-FGATCTCTAGACGCAGTTCTCCCTCCTGTTG; XbaIDeletion of mexZ; downstream fragment
mexZDD-RGCTAGAATTCGAAGGAAATCTTGGTGGCGA; EcoRIDeletion of mexZ; downstream fragment
PA0826.2DU-FGATCAAGCTTTCGAATACCGCCTGCAAGC; HindIIIDeletion of ssrA; upstream fragment
PA0826.2DU-RCTAGTCTAGACCGGCGTCGAATCCTAATC; XbaIDeletion of ssrA; upstream fragment
PA0826.2DD-FCTAGTCTAGAGCATGTAGAACCGATAGCGGA; XbaIDeletion of ssrA; downstream fragment
PA0826.2DD-RGCTAGGTACCCAGTCCTTCCTGGCGGCTAT; KpnIDeletion of ssrA; downstream fragment
PA4768DU-FGCTAGAATTCGCGGTAGATCTCCACCCGTT; EcoRIDeletion of smpB; upstream fragment
PA4768DU-RGATCTCTAGAGACCATAGGCGGCGCATTATAG; XbaIDeletion of smpB; upstream fragment
PA4768DD-FGATCTCTAGAGACTTCGACAAGCGCCACAC; XbaIDeletion of smpB; downstream fragment
PA4768DD-RGATCAAGCTTAGAGGCTTTGCGACGAAACTT; HindIIIDeletion of smpB; downstream fragment
  • a In some instances, restriction sites were introduced into oligonucleotides to be used for PCR, and these are underlined in the sequences, with the corresponding restriction endonucleases indicated.

  • b The PCR product amplified with these primers and cloned into pCR-BluntII-TOPO was excised following PstI-KpnI digestion (a PstI site is present within the pCR-BluntII-TOPO multicloning site) prior to cloning into pEX18Tc.