TABLE 1.

Primers used in this study

PrimeraSequence (5′→3′)bDescription
F1GAATACAATTCAACCTGCTAmplifies 435-bp meningococcal rp1O ORF
R1ATTTCAATCTTACCACCAA
F2GTTAAAAGCCTGATTGGTAAmplifies 186-bp meningococcal rpmD ORF
R2AAGACTCCACTTTCAACAA
F3GTTAACTCCCAAAATGTCTTAmplifies 519-bp meningococcal rpsE ORF
R3CAAAACATGAAATTGAAGAA
F4CGGGATCCCGTACAGCTCGCTTCTGAAATAmplifies 613-bp fragment of the meningococcal secY ORF
R4CCAAGCTTGGCTATTTGTATCAGCCGAACC
F5GAAGATTTTGGATTTGTTCGAmplifies 339-bp fragment of the meningococcal fur ORF
R5CACACGCCGTACATATAAAG
F6TCAAGCTCTTTAGGTTCTGCAmplifies 347-bp fragment of the meningococcal nspA ORF
R6ATGTAGTTGTAGCGGTAGCC
F7ATACGGTTGAAGTGGAATAmplifies 520-bp fragment of the meningococcal aniA ORF
R7AACATAAACTTTGTCGAAGA
F8CGGGATCCCGCAAGGTTTCATTTAATAAGAmplifies 111-bp promoter fragment of the meningococcal secY/ribosomal operon
R8CGGGATCCCGATCTAAGATGGTCTGCATTT
F9GCTCTAGAGCAAAATATTGCGATGCAAAAAmplifies 101-bp promoter fragment of the meningococcal nspA gene
R9CGGGATCCCGATATTTTGGTTCCTTTATGG
F10CGGGATCCCGCTGCTTCTTTATAGTGGAGAAmplifies 114-bp promoter fragment of the meningococcal rmp gene
R10CGGGATCCCGCCTCATTAAATTTGTACAGC
  • a F, forward; R, reverse.

  • b Restriction sites are underlined.