TABLE 1.

Synthetic oligonucleotide primers used for sequencing of the ply gene

PrimeraSequence (5′→3′)
27STACTTAGTCCAACCACGG
27RCTTGGCTACGATATTGGC
4WGATCATCAAGGTAAGGAA
4VCAATACAGAAGTGAAGGCGG
4TGTTGATCGTGCTCCGATGAC
9YCGGGATCCGGCAAATAAAGCAGTAAATGACTTT
27TATAAGTCATCGGAGCACG
15CGGAGGTAGAAGATGGCAAATAAAGC
15DCTAGTCATTTTCTACCTTATCCTCTACC
  • a Primers 27S and 27R were used for sequencing of the toxin gene in strains R75I, R76, R77, R84, COL15, and TIGR4. Primers 15C and 15D were used for sequencing of the toxin gene in strain R75II.