TABLE 1.

Bacterial strains, plasmids, and primers

Strain, plasmid, or primerGenotype, characteristics, or sequenceaSource or reference
E. coli strains
    DH5αLab stock
    BL21(DE3)/pLysSNovagen
    XL1-BlueStratagene
B. subtilis strains
    JH642pheA1 trpC2J. Hoch
    MH5124pheA1 trpC2 phoRΔBal1::Tetr26
    MH5538pheA1 trpC2 amyE::tuaA-lacZ Cmr36
    MH5913pheA1 trpC2 ΔphoPR ΔEcoRI::Tetr11
    MH6110pheA1 trpC2 ΔphoPR ΔEcoRI::Tetr amyE::phoA-lacZ Spcr11
    MH6111MH6110Ω/pCH10211
    MH7133MH6110Ω/pAE07This study
    MH7134pheA1 trpC2 phoRΔBal1::Tetr amyE::tuaA-lacZ CmrThis study
    MH7135MH6110Ω/pAE27This study
    MH7136MH6110Ω/pAE28This study
    MH7137MH6110Ω/pAE29This study
    MH7138MH6110Ω/pAE30This study
Plasmids
    pCR2.1Vector for cloning PCR products, Ampr KanrInvitrogen
    pDH88oriEc Pspac promoter, CmrD. Henner
    pCH102pDH88::phoPRWT 5′-polA (750 bp)11
    pLS53pDH88::Pspac-phoR173 Ampr Cmr55
    pLS21pGEX-2T GST-*phoR fusion, AmprThis study
    pWL32pET16b::phoP, Ampr55
    pAE01pCR2.1:: P, AmprThis study
    pAE07pDH88::phoPR173This study
    pAE27pDH88::phoPWTRC15A 5′-polA (750 bp)This study
    pAE28pDH88::phoPWTRC21A 5′-polA (750 bp)This study
    pAE29pDH88::phoPWTRC160A 5′-polA (750 bp)This study
    pAE30pDH88::phoPWTRC303A 5′-polA (750 bp)This study
    pAE31pGEX-2T GST-*phoRC303A fusion, AmprThis study
    pAE32pET16b::phoPD53A, AmprThis study
Primersb
    FMH892140CTGATTTGATTGTGCTTGCGGTGATGCTTCCAAAATTG177phoPD53A/pAE32
    FMH89631GTATTCGTTGTCGCCATGATTCTGGTGTTTTG62phoRC15A/pAE27
    FMH893177CAATTTTGGAAGCATCACCGCAAGCACAATCAAATCAG140phoPD53A/pAE32
    FMH89762CAAAACACCAGAATCATGGCGACAACGAATAC31phoRC15A/pAE27
    FMH89848GATTCTGGTGTTTGCCGTCCTCGGGCTGTTTTTAC82phoRC21A/pAE28
    FMH89982GTAAAAACAGCCCGAGGACGGCAAACACCAGAATC48phoRC21A/pAE28
    FMH900462GCTGACGGCCAGTCTTGCCACCGCATTTATCG493phoRC160A/pAE29
    FMH901493CGATAAATGCGGTGGCAAGACTGGCCGTCAGC462phoRC160A/pAE29
    FMH902891GACGGAGACAAAGAAAGCCAAGCTGTTAAGACTG924phoRC303A/pAE30
    FMH903924CAGTCTTAACAGCTTGGCTTTCTTTGTCTCCGTC891phoRC303A/pAE30
    FMH557cATAAGCTT−11GGAGGCACAGCATGAACAAGAAAATTTTAG19phoP/pAE01
    FMH558cCACCCGGG723TTATTCATTCATTTTTGGCTCCTCCAG697phoP/pAE01
  • a Tetr, tetracycline resistance; Cmr, chloramphenicol resistance; Spcr, spectinomycin resistance; Ampr, ampicillin resistance; Kanr, kanamycin resistance.

  • b The numbers are relative to the PhoP or PhoR + 1 start site (ATG).

  • c The underlined sequences are added restriction sites. FMH558 has a HindIII site, and FMH588 has a SmaI site.