TABLE 2.

PCR primers used in this study

TargetPrimerSequence (5′-3′)Reference
NonspecificrpsL-1GAATGTAGATGCCTACAATTAACCA17
rpsL-2GTGCGCCACGAACGATATG17
PemmPemm-L1GCATGGATCCCATCGCAAAGAGCTTA17
Pemm-R1GCGGCTCGAGTAGTGTCTATTCGTGTTATT17
Pemm1Pemm1-L1AAGCGATTATTGACAAGCTC1
Pemm1-R1AGTCAAAGCTACCGCTACTG1
PmgaOYL-25TACCATAAAATACCTTTC17
OYR-25GGTTGTACCATAACAGTC17
PrpsLGAS-rpsL1TGTCTAAAATCACATCTTCGAThis study
GAS-rpsL7TTACGTACCAACTGGTTAATTThis study
PsclAPsclA-L2TGGTAATCGTAATTGTCTGC1
PsclA-RATGGTGCTTTGATGTCAACA1
PscpAC5-L1AAGAATGAGATTAAGGAGGTCACA16
C5-R1GCGCAATGGCAAGTTTGTC16
PsofPsof-L3TTTGGTCTCAGACGGCGCCAThis study
Psof-L4AATCAAGGTCACAAACTTTCThis study
Psof-L5AATCGTCTGATAAGCTCTTGThis study
Psof-L6CACTCAGTTGCCTCCAAGCTThis study
Psof-R1ACCTCCTGTCCTAAAACTGTThis study
Psof-R2GAAAAAAGGGGTTGCCGCGAThis study
Psof-R3GTCAATGTTTCGTTAACCTTThis study
Psof-R4GGAAAGTTTGTGACCTTGATThis study
Psof-R5CGTCTGAGACCAAAGCGTTAThis study
Psof-R6GCTGCGCAAGGAGAAGCTCAThis study