TABLE 2.

Oligonucleotides used for sequencing relevant regions of genes that confer antibiotic resistance in mutant C. trachomatis

Gene(s) sequencedSense oligonucleotide(s) (sequence[s])Antisense oligonucleotide(s) (sequence[s])
gyrA gyrAB F7 (TGGGATACAACAATGAATCCTG) gyrAB R6 (ACACGAATCCCGTCTTTGTC)
folA TMP F3 (GGGACGAAAGACTTGGGAGT)CT611_170R (TCTGCTTTGCACATTCTTGC)
TMP F9 (ATTGAGCAAATGTTGCGTTG)TMP R22 (CCGCCCATGCTTATACTTGT)
folP _678_F (TTATCTACGCGTGCATCAGG)
rpoD promoterCT616_929_F (GGCAATTATTCGATGGGTTG) rpoD _112_R (ACGTGATGAACCCTTGATCC)
rpoB rpoB _F (ATGGGCGATGAGAAGACATC) rpoB _R (TGCATGTTCGATCCCATAAG)
rpoB _F1 (AACCCTGTCGCAGAATTGAC) rpoB _R1 (TCGAACTTCAAACCCAGCTC)
IGR610 and IGR61723SrRNA1814F (CCCAATGCCAAAAGGTTAAA)23srRNA2428R (CCCCGGAGTACCTTTTATCC)