TABLE 2.

Primer sequences used in this studya

PrimerSequence (5′-3′)
Pro-198CAGCTGTTAAAGCACCTTATGTTCG
Pro-199CCCCAAGTAATCAAGTGGAAACCGG
Pro-200CGCCCACTCCTTTGCTGAAAACAG
Pro-215CCAGCCTTGAAGCGATTGC
Pro-216CCATTCGGGCCTTTTTCG
Pro-221 (EcoRI)GAATTCGAGATTCCTTTACAAATATGCTCTTAC
Pro-222 (EcoRI)CGAATTCGTTCGGAATAGGTTATACTAGACAAAAG
Pro-238CGGTCAAATCTTCAGGTAATCGAA
Pro-239GCTGCCAGGTTCGCTATTCGAAC
Pro-240AGGTAAGCTATTGAGAAGGAGATCC
Pro-246CAATGCCGGTGACGGATAACAACTGG
Pro-247GATGCATGGAAGTATGAACGGGAC
Pro-340GATCACACTGCAGTTAAGGCGCC
Pro-341GTGTTCAATTGTATGCAACCCGGC
Pro-LuxFCCTTCGCCGACTGAGTCGACGCTGCCAGGTTCGCTATTCGAAC
Pro-LuxRCTCTCGAGGATTGAACGTATCCATGCTG
Pro-533 (BamHI)ATGGATCCCAAGCCTCAGACAACCTGAC
Pro-538 (NdeI)AACATATGACAGAAGAAGTTCAAA
Pro-569 (BamHI)ATGGATCCGTTGTTCCATTGCTGCGTGT
Pro-578 (BamHI)ATGGATCCGTTGTTCCCATGAGACACCTCC
  • a Note that restriction sites present in the primer sequence are underlined, and the respective restriction enzymes are indicated in parentheses.