TABLE 2.

Oligonucleotide primers and TaqMan probes used in RT-PCR analysis of gene expression

PrimerSequence (5′→3′)Binding position within ICEHin1056 (bp)
RTTF1FTTATGGTTTACCTGGGC27426-27442
RTTF1RCGACCACAACAGTTACAACAC27590-27610
RTTF2FGCTGATCGTGTACTGCAATATG28983-29004
RTTF2RGAAAGCAGCCCCTAATCCATATCC30610-30633
RTTF3FGTGGTGCGGGAATGCAGGTAAC32057-32078
RTTF3RGGTTGCTATATCTTGACTTGGCGC32548-32571
RTTF4FGGTGGCAATCTGCATTTTCTG32522-32542
RTTF4RGCACCCATAATGACAACATAGA33742-33763
RTTF5FTGGCGCTATAAGTGCTCAAG33943-33962
RTTF5RGATAACCCGCCATACACACT34966-34985
RTTF6FGAATTGCTATCGGTGCATTGC35344-35364
RTTF6RGCAGATGCCGTCATTGGTG35980-35998
RTTF7FCTGCATTGCCTGTGCGA36499-36515
RTTF7RATTATGCTGAAATGTTGCTGC36633-36653
RTTF8FGGTTGTACAAGCTGGTAATC37218-37237
RTTF8RCCAGAGACAATTGCGCCTTC37687-37706
RTTF9FGCAGACTGGTTCCGTCAG38053-38070
RTTF9RAACCTGGTACAGGCATTTGCTCTG38540-38563
RTTF10FGATAATATTCGTAAGCAGCCAG39646-39667
RTTF10RGAATAGCCGAGCGGTCAG40634-40651
RTTF11FCATTTCCTCAGCGTGTATTTAC41664-41685
RTTF11RGTCGTAAATGGCGCATAGCC42619-42638
RTTF12FCCAGTGTTATATTCACGTAGCTC45686-45708
RTTF12RAGAAGATCCCGATGCTCAAGTG45949-45970
RTTF13FCAGCCGAATTTTGTACAAAATAAC47761-47784
RTTF13RGAGCTTGCAAGCCAGGTG48254-48271
RTTF1F2CCCGATGGCTTTACGTGATGC28295-28315
RTTF1R2GCAGCTCTCGCTCCATGCGG28819-28839
RTTF2F2GGATTAATGATGCGTGACCGTCG33514-33536
RTTF2R2CCCTGCCTGCACAGTAGTAATATC34097-34120
RTTF3F2CTCTGTGAGGTCAAGATGTC34891-34910
RTTF4F2CAAGGTCGATTCTATGCAGC36618-36637
RTTF5F2CCCGTACAGCAGAAAACGAGG38447-38467
RTTF5R2CGCTGCTTCTTCCCTCAGTTCC38974-38995
RTTF6F2GGGGATTGCAGTCAATGACG41478-41497
RTTF7F2GACATTAGCCCCTCTTATCCC42516-42536
RTTF7R2CATAAGCGTAAATAGAGATAAAAT44556-44579
RTTF8F2CTCCGGCCAAAATTGGACTC44017-44036
RTTF8R2CACAATAGTAACAGTATTGAAGAGCC44675-44700
RTTF9F2GCACTACCCGCTTTACAGCTCACC44615-44638
RTTF9R2CCAGGCATCTGCGCAATCAGG45104-45124
RTTF10F2GAAGCTGATACTGGCATGG46916-46934
RTTF11F2GCTGAGCTGCTACACTAGGATTCG48175-48198
RTTF11R2GCCCAAGTGTTTTCCCACACG48844-48864
RTTF1F3GGGGATTCATCAGCACTTTGATTG26625-26648
RTTF1R3ATGCGGTTGCTATCATCCAAGTG27228-27250
RTTF2F3CCTGGTGTCGGGTGATAGG27131-27149
RTTF2R3TTGTTGCTCATCGGCTGTTTG27915-27935
RTTF3F3GGCGGTGGTAATGGTATCAATGC34581-34603
RTTF3R3GCCTCATATTCTTCCGCTTGGC48989-49010
QRTTF1FGCCCGGAACGTGCATCT40766-40782
QRTTF1RCCATTTACCCCAGTGCAGAAA40815-40835
QRTTF1PTCTTGCAGATATGGCCGAAGCAATGG40785-40810
QRTTF2FCGTGCTGCATTTCATTGCTAA41605-41625
QRTTF2RCGCTGAGGAAATGCGCTTA41658-41676
QRTTF2PATTAAGACAAAAATTGGTTCAAACTGCC41627-41656