TABLE 1.

Primer sequences used for mutant construction and verification

Primer namePrimer sequence (5′-3′)
kpsM-F2CATCGTGCTTACATATCTTGGTGC
kpsM-R2TTCTTTTGGCTTTAACTCTCCGAC
prmAFAAAACTACACCACTCATTGATTTGC
1121RCGCATATGGGTGGTAATGAATTAAA
pglG-F2GCTTTTCCACCCTCAGTTGTAAC
pglG-R2GCACTAAGAGAGTTTGCGAGC
1127FTATCAAAGGCTTTAGCCCTAGTTTT
1129RTTATTATCGCAACTTTAAATTCAGG
wlaBgalE-F1GCTATTTCATCATCACAACCTACC
wlaBgalE-R1GCCAGATGTTGAGCTTATCCG
ckanBCCTGGGTTTCAAGCATTAG