TABLE 1.

Oligonucleotides used for PCR amplificationa

OligonucleotideSequence (5′-3′)Use
EpsB1FGTTAAAGTTGATGATGTTGCCepsB deletion mutant; left flanking region amplification
1BRCGGGATCCGTGAGTGAACGTCAATCACepsB deletion mutant; left flanking region amplification
2BFCGGGATCCCCAAAACATTACTAGAAAATCepsB deletion mutant; right flanking region amplification
2BRCGTTTCATTTAGATCGGCATTTCCTGAAepsB deletion mutant; right flanking region amplification
EpsC1FATAATCTCCAAGACTCTGTCCepsC deletion mutant; left flanking region amplification
EpsC1RCGGGATCCAGTGTTATCTTGepsC deletion mutant; left flanking region amplification
EpsC2FCGGGATCCCTTGGAATTGTCepsC deletion mutant; right flanking region amplification
EpsC2RTAGGTGCTGTTGGTTCAGAGepsC deletion mutant; right flanking region amplification
1DFGCTCACATGTCCTCAAACCAAAGCTCepsD deletion mutant; left flanking region amplification
1DRCGGGATCCCTCTTCCGTCTTTTTAGCAepsD deletion mutant; left flanking region amplification
2DFCGGGATCCGTCGGTTGGAATTAACGCGTepsD deletion mutant; right flanking region amplification
2DRCATATTTCGGTTTAATTTCTCTTACGAGAAepsD deletion mutant; right flanking region amplification
1EFGCCAGAGTCACCATCTTCACCepsE deletion mutant; left flanking region amplification
1ERGCGGATCCCTTTAGCTTGTGACATCTCATTCepsE deletion mutant; left flanking region amplification
2EFCGGGATCCGAGTTGGAGCGCGTTAGTACTGepsE deletion mutant; right flanking region amplification
2ERCCACTCTAAGTCAATCAAATAACCepsE deletion mutant; right flanking region amplification
EHNFGCGGATCCATGTCACAAGCTAAAGAGGAAATTInsertion of epsE open reading frame into pQE-30 to produce His6-EpsE
EHNRCCCAAGCTTCTAACGCGCTCCAACTCTCTTCAAAACAATCInsertion of epsE open reading frame into pQE-30 to produce His6-EpsE
P-eps-FGGAATTCGCAGACTAGTTTGTAAAAGGACGeps promoter amplification to construct pJIM4843
P-eps-RCGCGGATCCCCATTACTCGTATGCTTTTGCeps promoter amplification to construct pJIM4843
  • a Oligonucleotide primers were derived from the eps gene sequence of CNRZ1066 (accession number CP000024). In some cases, additional nucleotides were added to create restriction sites (underlined).