TABLE 4.

Oligonucleotide primers for RT-PCR quantification of transcripts by SYBR green chemistry

Primer namePrimer sequenceGene
200SYBRPTCAACAGTCAAGCAACCCCTAATdnaJ3
200SYBRMTTTGCAATTCACCATCGGTTT
205SYBRPTCAATCGTTTTGTGTTGCTGGhrcA
205SYBRMACACTTCTTAAGCGGGTTTTCAGA
239SYBRPGAGATAGCAAACCGATTGGAAAAlon
239SYBRMTAAATCTTCAATCCCTGCTTGGA
305SYBRPTACCGCTTCTAACTTTATTCCAGTTGdnaK
305SYBRMAATTGTGTTGCACCTTCCCC
355SYBRPAAGTTTCTGAAAATGAAATTGCTGAAclpB
355SYBRMGAATTCCTGTTGTTTGTGAAATAACTTC
393SYBRPAAGGTTATTTCAGTTGCTGCAGTGgroES
393SYBRMACCATCCCCAGCAATGTCAT
275SYBRPCACTGATGATCTTTTCTATTCCAACCnox
275SYBRMGCGCCCATCTGTTTCAACTC
407SYBRPATGAAGGTGGATTTGCGCCeno
407SYBRMTGTCAAGTGCATCTTCTGCAAGTT