TABLE 1.

Primers used in this study

PrimerForward sequenceReverse sequence
cat constructsa
    −599 (BamHI)CGAGGATCCCGCACATACTCCAGTAAA
    −518 (HindIII)CGATACAAGCTTTTGACTTGCGAAT
    −363 (HindIII)CGATACAAGCTTGATGTTCTCAACA
    −325 (HindIII)CGATACAAGCTTTGACAACCAA
    −217 (HindIII)CGATACAAGCTTGAACGGTCTTTAT
    −105 (HindIII)CCGTCCAAGCTTACACTATTGTATT
    −465 (HindIII)AAGCTTCTCGTCATATTAATG
    +137 (EcoRI)CGGAATTCCCCTTGTAATCGATGTGCT
    −12 (EcoRI)CGAGACGAATTCTCATTAGAACTC
    −49 (EcoRI)GAATTCTCGCCACTGCCATAAATTA
    −88 (EcoRI)GGAATTCGCCAAATACAATAGTGTTA
    −171(EcoRI)GAATTCGCACCTCTTAAAGTTCTTAGT
    −393 pdltSx-USGCAAAATTATCTAAGAATAAACAAATGTTTTGG
    −3 pdltSx-DSCCTTCATAGAATTCTCCTCGACTAAAATTC
Real-time RT-PCR
    dltACACAGAGCAGCAAAAGCGTTAGACATATGGTCCAACTGAAGCTACG
    dltDTGACCCATTTAATCCTGCAATTGTCTGTAGAACCACCAGCACCTAATAA
    gapdhTACACAAGACGCACCTCACAGAACCTGTTGAGTTAGGGATGATGGT
    16S rRNAAGCCGACCTGAGAGGGTGATCTGGACCGTGTCTCAGTTCC
    catGAAATTTATCCTTCTTTGATTTATGCACCTGTTCTAAACACTTTATTTTTATTTACAACTTC
Northern blot probes
    1 (−599/−341)CACATACTCCAGTAAATTGAAAATAAGGATACACTTTGTTGAGAACATCATTCAT
    2 (−217/−31)TATATTGAACGGTCTTTATAAAGGCGATGAAGTTATTGTGTGTGTCGCC
    3 (+178/+876)ATATGATTGTTGGGATGATTGGTGCCAACATATGGTCCAACTGAAGCTACG
    4 (+2603/+3227)AGCATTGTGATTACATTCCACTTTGTTCTGTAGAACCACCAGCACCTAATAA
SMART RACE analysis
    TK42 (+959)GCGCTTGGTCTTTCAACGCCAACAGGT
    TK43 (+204)TGGCACCAATCATCCCAACAATCATAT
  • a DNA region (in bp), relative to dltA translation start site that is fused to cat gene. See also Fig. 6. Restriction sites are underlined.