TABLE 1.

Oligonucleotides used in this study

NameSequence (5′-3′)Experiment(s)
rpoSR422TTGGGCGATTTTTCTTCTTCTranscript initiation
rpoSR232ATCCCAAGTTGCCTTCTTCATranscript initiation, qRT-PCR
rpoSR125TTTGCTTTTGCATTGCCTCTTranscript initiation
EMSA_rpoS1aACTTAATTTCCATGCAAAAACTGTGCCAATTTAATTTAAAEMSA
EMSA_rpoS2aTTTAAATTAAATTGGCACAGTTTTTGCATGGAAATTAAGTEMSA
rpoS promoterFaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGGCACAGTTTTTGCATGGAAATTAAGTAGEMSA
rpoS promoterRaCTACTTAATTTCCATGCAAAAACTGTGCCAATTTAATTTAAAAATGGTTTTAAACTAAATAGGEMSA
rpoS_C-12AaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGGCACAGTTTTTGAATGGAAATTAAGTAGPromoter mutants, EMSA
rpos_G-12TaCTACTTAATTTCCATTCAAAAACTGTGCCAATTTAATTTAAAAATGGTTTTAAACTAAATAGGPromoter mutants, EMSA
rpoS_T-18GaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGGCACAGGTTTTGCATGGAAATTAAGTAGEMSA
rpoS_A-18CaCTACTTAATTTCCATGCAAAACCTGTGCCAATTTAATTTAAAAATGGTTTTAAACTAAATAGGEMSA
rpoS_G-24TaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGTCACAGTTTTTGCATGGAAATTAAGTAGPromoter mutants, EMSA
rpoS_C-24AaCTACTTAATTTCCATGCAAAAACTGTGACAATTTAATTTAAAAATGGTTTTAAACTAAATAGGPromoter mutants, EMSA
rpoS_d-20FaCTACTTAATTTCCATGCAAAAAC-GTGCCAATTTAATTTAAAAATGGTTTTAAACTAAATAGGPromoter mutants, EMSA
rpoS_d-20RaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGGCAC-GTTTTTGCATGGAAATTAAGTAGPromoter mutants, EMSA
rpoS_d-17/18FaCTACTTAATTTCCATGCAAA-CTGTGCCAATTTAATTTAAAAATGGTTTTAAACTAAATAGGPromoter mutants, EMSA
rpoS_d-17/18RaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGGCACAG-TTTGCATGGAAATTAAGTAGPromoter mutants, EMSA
rpoS_d-10FaCTACTTAATTTCC-TGCAAAAACTGTGCCAATTTAATTTAAAAATGGTTTTAAACTAAATAGGEMSA
rpoS_d-10RaCCTATTTAGTTTAAAACCATTTTTAAATTAAATTGGCACAGTTTTTGCA-GGAAATTAAGTAGEMSA
flgB promoterFbAAAATACAAATTAACGAACAAAAAGATTTGAATTATTATATAATTTAGTTAAAAGCATTTTAAEMSA
flgB promoterRbTTAAAATGCTTTTAACTAAATTATATAATAATTCAAATCTTTTTGTTCGTTAATTTGTATTTTEMSA
rpoSF30CATATATTTAAAATCAGTAAGAGAACACAAGCTAATTACTCACGAAGAAGqRT-PCR
flaBF9CAATCATAATACATCAGCTATTAATGCTTCAAGqRT-PCR
flaBR82CTTGAGTTTTACTAAGATTAGCAGCGTTAATGqRT-PCR
  • a The putative −24/−12 region of the rpoS promoter is underlined, and nucleotides deleted are shown with dashes.

  • b The −35 and −10 promoter sequences are underlined.