TABLE 2.

Primers used for gene mutagenesis

PrimerSequenceGene mutated
RpoS-P1GTCAGAATACGCTGAAAGTTCATGATTTAAATGAAGACGCGGAGTGTAGGCTGGAGCTGCTTC rpoS
RpoS-P2CTCGCGGAACAGCGCTTCGATATTCAGCCCCTGCGTCTGCAGACATATGAATATCCTCCTTAG rpoS
Crl-P1CAGTTGCTTCATTAAAGGAGATCGCAATGACGTTACCGAGTGGGTGTAGGCTGGAGCTGCTTC crl
Crl-P2CTGATGGCGCTGCGCCATCAGGCATGGCAGCAGGGTTATGCCGCATATGAATATCCTCCTTAG crl
CsgB-P1GATAATTTTCGCTATGTACGACCAGGTCCAGGGTGACAGCATGAAAGTGTAGGCTGGAGCTGCTTC csgB
CsgB-P2CCCATCGGATTGATTTAAAAGTCGTAACGGTATTAGCGTTGGGTGCATATGAATATCCTCCTTAG csgB
CsgD-P1GCTGTCAGATGTGCGATTAAAAAAAGTGGAGTTTCATCATGTTGTGTAGGCTGGAGCTGCTTC csgD
CsgD-P2GCTGCTACAATCCAGGTCAGATAGCGTTTCATGGCCTTACCGCCATATGAATATCCTCCTTAG csgD